Incidental Mutation 'R7796:Smg5'
ID600214
Institutional Source Beutler Lab
Gene Symbol Smg5
Ensembl Gene ENSMUSG00000001415
Gene NameSmg-5 homolog, nonsense mediated mRNA decay factor (C. elegans)
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7796 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location88336260-88362338 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 88349432 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 299 (Q299L)
Ref Sequence ENSEMBL: ENSMUSP00000001451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001451]
Predicted Effect probably damaging
Transcript: ENSMUST00000001451
AA Change: Q299L

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000001451
Gene: ENSMUSG00000001415
AA Change: Q299L

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
Pfam:EST1 77 189 1.1e-26 PFAM
Pfam:EST1_DNA_bind 197 427 4.6e-53 PFAM
low complexity region 447 468 N/A INTRINSIC
low complexity region 481 501 N/A INTRINSIC
Pfam:EST1_DNA_bind 611 745 3.7e-9 PFAM
coiled coil region 801 842 N/A INTRINSIC
PINc 856 979 3.23e-15 SMART
low complexity region 990 999 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192009
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SMG5 is involved in nonsense-mediated mRNA decay (Ohnishi et al., 2003 [PubMed 14636577]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630089N07Rik T A 16: 98,065,824 I313F probably benign Het
Acot2 T A 12: 83,988,483 probably null Het
Agbl4 G T 4: 110,660,968 G152V unknown Het
Arap2 A G 5: 62,730,762 S414P probably damaging Het
C330021F23Rik T C 8: 3,584,160 V111A probably benign Het
Cep85l A C 10: 53,281,401 N735K probably damaging Het
Col12a1 T C 9: 79,678,551 S1209G possibly damaging Het
Dennd1b G A 1: 139,062,873 E192K probably damaging Het
Dpf1 C G 7: 29,311,681 N168K possibly damaging Het
Dync1li2 T A 8: 104,430,549 Y184F probably damaging Het
Epb41l2 A G 10: 25,443,829 T187A probably benign Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fndc3b G A 3: 27,461,743 T638I probably benign Het
Gm11564 A G 11: 99,815,598 V2A unknown Het
Gm13088 T A 4: 143,654,157 D432V possibly damaging Het
Gm3159 A G 14: 4,400,560 *206W probably null Het
Gm32742 A G 9: 51,159,823 probably null Het
Gm4847 G A 1: 166,642,250 H85Y probably damaging Het
Gprc5c A T 11: 114,864,532 D345V probably damaging Het
Kalrn A T 16: 34,187,484 Y1363* probably null Het
Kdm5a T C 6: 120,390,763 V473A probably damaging Het
Kidins220 T C 12: 24,982,351 C28R probably damaging Het
Klhl5 T C 5: 65,164,622 Y664H probably damaging Het
Krt17 A G 11: 100,260,872 S32P probably benign Het
Krt83 A G 15: 101,485,984 V424A possibly damaging Het
Lipo1 T C 19: 33,782,234 T201A possibly damaging Het
Map2 A G 1: 66,416,495 probably null Het
Megf10 C A 18: 57,277,659 T680N possibly damaging Het
Metap1d T A 2: 71,512,162 D178E probably damaging Het
Miip C T 4: 147,862,918 G236S probably benign Het
Mki67 A G 7: 135,698,194 S1704P probably damaging Het
Nr2f2 A G 7: 70,358,153 S194P probably benign Het
Nrsn2 T A 2: 152,376,551 probably benign Het
Ociad1 C T 5: 73,294,947 P27L probably damaging Het
Olfr1238 T A 2: 89,406,813 T89S possibly damaging Het
Olfr1339 T A 4: 118,734,685 I52N probably damaging Het
Patj A T 4: 98,546,983 M1L probably benign Het
Pcdhb2 A G 18: 37,295,393 I140V possibly damaging Het
Pla2g6 T C 15: 79,317,825 N49D probably benign Het
Pxdc1 T A 13: 34,652,371 N22I probably damaging Het
Rpgrip1l A G 8: 91,270,237 Y672H probably damaging Het
Safb2 T C 17: 56,566,327 R779G possibly damaging Het
Skiv2l C T 17: 34,844,418 G628S probably damaging Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Sulf1 T C 1: 12,858,820 L864S probably benign Het
Tas1r1 A G 4: 152,034,755 V119A probably benign Het
Tasp1 T C 2: 140,008,785 N106S probably damaging Het
Tcf4 T A 18: 69,564,069 N156K probably benign Het
Trav14n-3 T A 14: 53,370,370 Y52* probably null Het
Ttn T C 2: 76,834,878 E11598G unknown Het
Unc80 A G 1: 66,503,714 I376V probably benign Het
Ybx3 T C 6: 131,368,516 E298G probably damaging Het
Yipf7 T C 5: 69,527,253 Y73C possibly damaging Het
Zdbf2 G A 1: 63,303,424 A321T possibly damaging Het
Zfp369 A G 13: 65,296,215 R391G probably benign Het
Zfp54 A G 17: 21,434,720 E492G probably damaging Het
Zfp971 A G 2: 178,031,610 T51A probably benign Het
Other mutations in Smg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Smg5 APN 3 88351428 nonsense probably null
IGL00902:Smg5 APN 3 88353085 missense probably benign 0.00
IGL00990:Smg5 APN 3 88343038 critical splice donor site probably null
IGL01371:Smg5 APN 3 88359644 unclassified probably benign
IGL01536:Smg5 APN 3 88349245 missense possibly damaging 0.58
IGL02215:Smg5 APN 3 88352998 missense possibly damaging 0.47
IGL03366:Smg5 APN 3 88346452 nonsense probably null
R0013:Smg5 UTSW 3 88349233 missense probably benign 0.00
R0017:Smg5 UTSW 3 88351105 missense probably damaging 1.00
R0017:Smg5 UTSW 3 88351105 missense probably damaging 1.00
R0129:Smg5 UTSW 3 88349233 missense probably benign 0.00
R0153:Smg5 UTSW 3 88353872 unclassified probably benign
R1386:Smg5 UTSW 3 88355671 missense probably damaging 1.00
R1941:Smg5 UTSW 3 88345380 missense possibly damaging 0.71
R2185:Smg5 UTSW 3 88351561 missense probably benign
R2282:Smg5 UTSW 3 88345398 missense probably benign 0.02
R3615:Smg5 UTSW 3 88336451 missense possibly damaging 0.94
R3616:Smg5 UTSW 3 88336451 missense possibly damaging 0.94
R4008:Smg5 UTSW 3 88349158 missense probably benign 0.01
R4687:Smg5 UTSW 3 88342469 missense possibly damaging 0.83
R4726:Smg5 UTSW 3 88336451 missense possibly damaging 0.94
R4801:Smg5 UTSW 3 88355692 nonsense probably null
R4802:Smg5 UTSW 3 88355692 nonsense probably null
R4977:Smg5 UTSW 3 88355725 nonsense probably null
R5384:Smg5 UTSW 3 88351293 missense probably damaging 1.00
R5443:Smg5 UTSW 3 88354589 missense probably damaging 0.99
R5779:Smg5 UTSW 3 88351618 unclassified probably benign
R5860:Smg5 UTSW 3 88342907 missense probably damaging 0.97
R6080:Smg5 UTSW 3 88351509 missense probably benign
R6263:Smg5 UTSW 3 88341901 missense possibly damaging 0.90
R6431:Smg5 UTSW 3 88351220 missense probably benign 0.00
R6722:Smg5 UTSW 3 88353025 missense probably damaging 0.99
R6847:Smg5 UTSW 3 88342552 missense probably damaging 1.00
R6950:Smg5 UTSW 3 88349269 critical splice donor site probably null
R7091:Smg5 UTSW 3 88351347 missense probably benign 0.00
R7395:Smg5 UTSW 3 88361071 missense probably damaging 0.99
R7678:Smg5 UTSW 3 88353895 missense possibly damaging 0.93
Z1177:Smg5 UTSW 3 88351134 missense probably damaging 1.00
Z1177:Smg5 UTSW 3 88352990 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- GCCAAAATGTACCACCAGTTG -3'
(R):5'- AGTGTCTACCGAGTCACTTGG -3'

Sequencing Primer
(F):5'- TGTACCACCAGTTGAAGAAGTCTG -3'
(R):5'- GGTCACTCCTCTAGCATCTAATGAG -3'
Posted On2019-11-26