Mutagenetix > Incidental Mutations

Incidental Mutation 'R7796:Gprc5c'

600239

Institutional Source

Beutler Lab

Gene Symbol

Gprc5c

Ensembl Gene

ENSMUSG00000051043

Gene Name

G protein-coupled receptor, family C, group 5, member C

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.302) question?

Stock #

R7796 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

114851152-114872617 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 114864532 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 345 (D345V)

Ref Sequence

ENSEMBL: ENSMUSP00000061760 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021071] [ENSMUST00000053361] [ENSMUST00000122967] [ENSMUST00000133245] [ENSMUST00000136785] [ENSMUST00000142262] [ENSMUST00000152314] [ENSMUST00000177952]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000021071
AA Change: D345V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000021071
Gene: ENSMUSG00000051043
AA Change: D345V

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:7tm_3	58	302	1.3e-42	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000053361
AA Change: D345V

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000061760
Gene: ENSMUSG00000051043
AA Change: D345V

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:7tm_3	60	301	1.3e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000122967

SMART Domains

Protein: ENSMUSP00000114335
Gene: ENSMUSG00000051043

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
transmembrane domain	55	77	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000133245

SMART Domains

Protein: ENSMUSP00000121572
Gene: ENSMUSG00000051043

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
transmembrane domain	55	77	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000136785

SMART Domains

Protein: ENSMUSP00000116786
Gene: ENSMUSG00000051043

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:7tm_3	58	283	1.5e-38	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000142262

SMART Domains

Protein: ENSMUSP00000121524
Gene: ENSMUSG00000051043

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:7tm_3	58	133	6.2e-14	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000152314
AA Change: D14V

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)

Predicted Effect

probably damaging
Transcript: ENSMUST00000177952
AA Change: D345V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000136702
Gene: ENSMUSG00000051043
AA Change: D345V

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:7tm_3	58	302	1.3e-42	PFAM

Meta Mutation Damage Score

0.2691

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

100% (54/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the type 3 G protein-coupled receptor family. Members of this superfamily are characterized by a signature 7-transmembrane domain motif. The specific function of this protein is unknown; however, this protein may mediate the cellular effects of retinoic acid on the G protein signal transduction cascade. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter allele are behaviorally normal but exhibit reticulocytosis, increased mean corpuscular volume, increased percentage of basophils, decreased mean corpuscular hemogloblin concentration, and increased alkaline phophatase and lactic dehydrogenase levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A630089N07Rik	T	A	16: 98,065,824	I313F	probably benign	Het
Acot2	T	A	12: 83,988,483		probably null	Het
Agbl4	G	T	4: 110,660,968	G152V	unknown	Het
Arap2	A	G	5: 62,730,762	S414P	probably damaging	Het
C330021F23Rik	T	C	8: 3,584,160	V111A	probably benign	Het
Cep85l	A	C	10: 53,281,401	N735K	probably damaging	Het
Col12a1	T	C	9: 79,678,551	S1209G	possibly damaging	Het
Dennd1b	G	A	1: 139,062,873	E192K	probably damaging	Het
Dpf1	C	G	7: 29,311,681	N168K	possibly damaging	Het
Dync1li2	T	A	8: 104,430,549	Y184F	probably damaging	Het
Epb41l2	A	G	10: 25,443,829	T187A	probably benign	Het
Fam50b	G	A	13: 34,747,101	E187K	possibly damaging	Het
Fndc3b	G	A	3: 27,461,743	T638I	probably benign	Het
Gm11564	A	G	11: 99,815,598	V2A	unknown	Het
Gm13088	T	A	4: 143,654,157	D432V	possibly damaging	Het
Gm3159	A	G	14: 4,400,560	*206W	probably null	Het
Gm32742	A	G	9: 51,159,823		probably null	Het
Gm4847	G	A	1: 166,642,250	H85Y	probably damaging	Het
Kalrn	A	T	16: 34,187,484	Y1363*	probably null	Het
Kdm5a	T	C	6: 120,390,763	V473A	probably damaging	Het
Kidins220	T	C	12: 24,982,351	C28R	probably damaging	Het
Klhl5	T	C	5: 65,164,622	Y664H	probably damaging	Het
Krt17	A	G	11: 100,260,872	S32P	probably benign	Het
Krt83	A	G	15: 101,485,984	V424A	possibly damaging	Het
Lipo1	T	C	19: 33,782,234	T201A	possibly damaging	Het
Map2	A	G	1: 66,416,495		probably null	Het
Megf10	C	A	18: 57,277,659	T680N	possibly damaging	Het
Metap1d	T	A	2: 71,512,162	D178E	probably damaging	Het
Miip	C	T	4: 147,862,918	G236S	probably benign	Het
Mki67	A	G	7: 135,698,194	S1704P	probably damaging	Het
Nr2f2	A	G	7: 70,358,153	S194P	probably benign	Het
Nrsn2	T	A	2: 152,376,551		probably benign	Het
Ociad1	C	T	5: 73,294,947	P27L	probably damaging	Het
Olfr1238	T	A	2: 89,406,813	T89S	possibly damaging	Het
Olfr1339	T	A	4: 118,734,685	I52N	probably damaging	Het
Patj	A	T	4: 98,546,983	M1L	probably benign	Het
Pcdhb2	A	G	18: 37,295,393	I140V	possibly damaging	Het
Pla2g6	T	C	15: 79,317,825	N49D	probably benign	Het
Pxdc1	T	A	13: 34,652,371	N22I	probably damaging	Het
Rpgrip1l	A	G	8: 91,270,237	Y672H	probably damaging	Het
Safb2	T	C	17: 56,566,327	R779G	possibly damaging	Het
Skiv2l	C	T	17: 34,844,418	G628S	probably damaging	Het
Smg5	A	T	3: 88,349,432	Q299L	probably damaging	Het
Sptbn2	C	G	19: 4,749,012	R2037G	probably benign	Het
Sulf1	T	C	1: 12,858,820	L864S	probably benign	Het
Tas1r1	A	G	4: 152,034,755	V119A	probably benign	Het
Tasp1	T	C	2: 140,008,785	N106S	probably damaging	Het
Tcf4	T	A	18: 69,564,069	N156K	probably benign	Het
Trav14n-3	T	A	14: 53,370,370	Y52*	probably null	Het
Ttn	T	C	2: 76,834,878	E11598G	unknown	Het
Unc80	A	G	1: 66,503,714	I376V	probably benign	Het
Ybx3	T	C	6: 131,368,516	E298G	probably damaging	Het
Yipf7	T	C	5: 69,527,253	Y73C	possibly damaging	Het
Zdbf2	G	A	1: 63,303,424	A321T	possibly damaging	Het
Zfp369	A	G	13: 65,296,215	R391G	probably benign	Het
Zfp54	A	G	17: 21,434,720	E492G	probably damaging	Het
Zfp971	A	G	2: 178,031,610	T51A	probably benign	Het

Other mutations in Gprc5c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01599:Gprc5c	APN	11	114864252	missense	probably benign	0.01
IGL01762:Gprc5c	APN	11	114864024	missense	probably benign	0.28
IGL02039:Gprc5c	APN	11	114864486	nonsense	probably null
R0800:Gprc5c	UTSW	11	114866711	missense	probably damaging	0.99
R1618:Gprc5c	UTSW	11	114864394	missense	possibly damaging	0.88
R4198:Gprc5c	UTSW	11	114863860	missense	probably damaging	1.00
R4807:Gprc5c	UTSW	11	114864498	missense	probably damaging	0.97
R4846:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R4902:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R4904:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5016:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5048:Gprc5c	UTSW	11	114870351	makesense	probably null
R5106:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5109:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5173:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5266:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5267:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5475:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5508:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5557:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5562:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5563:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5598:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5599:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5729:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5756:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5792:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5793:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5794:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5817:Gprc5c	UTSW	11	114863624	nonsense	probably null
R5976:Gprc5c	UTSW	11	114864487	missense	possibly damaging	0.89
R6151:Gprc5c	UTSW	11	114864025	missense	probably damaging	1.00
R6617:Gprc5c	UTSW	11	114864105	missense	probably benign	0.05
R7108:Gprc5c	UTSW	11	114864282	missense	probably damaging	1.00
R7191:Gprc5c	UTSW	11	114868617	missense	possibly damaging	0.56
R8543:Gprc5c	UTSW	11	114864268	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTCGCTGCCAATGCCTG -3'
(R):5'- CATGGGATGAAAATCAGCAACA -3'

Sequencing Primer
(F):5'- TAGCCCAGAACAGAGCTA -3'
(R):5'- ACAGATTTGAGTTCCAGGCC -3'

Posted On

2019-11-26