Incidental Mutation 'R7796:Kalrn'
ID 600249
Institutional Source Beutler Lab
Gene Symbol Kalrn
Ensembl Gene ENSMUSG00000061751
Gene Name kalirin, RhoGEF kinase
Synonyms 2210407G14Rik, Hapip, E530005C20Rik, LOC224126
MMRRC Submission 045852-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.934) question?
Stock # R7796 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 33969073-34573532 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 34187484 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 1363 (Y1363*)
Ref Sequence ENSEMBL: ENSMUSP00000110611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076810] [ENSMUST00000089655] [ENSMUST00000114947] [ENSMUST00000114949] [ENSMUST00000114953] [ENSMUST00000114954] [ENSMUST00000114960] [ENSMUST00000151491]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000076810
AA Change: Y1345*
SMART Domains Protein: ENSMUSP00000076088
Gene: ENSMUSG00000061751
AA Change: Y1345*

DomainStartEndE-ValueType
SEC14 20 159 2.22e-30 SMART
SPEC 173 289 5.32e-9 SMART
SPEC 295 397 1.19e-11 SMART
SPEC 400 515 1.83e0 SMART
SPEC 521 623 9.84e-13 SMART
SPEC 626 748 2.74e-2 SMART
SPEC 875 976 8.11e-14 SMART
SPEC 1106 1208 4.7e-10 SMART
RhoGEF 1258 1428 3.6e-56 SMART
PH 1442 1555 5.24e-8 SMART
SH3 1622 1683 1.23e-7 SMART
RhoGEF 1904 2074 1.47e-52 SMART
PH 2094 2199 9.87e-4 SMART
SH3 2295 2356 2.78e-2 SMART
IGc2 2455 2527 4.28e-12 SMART
FN3 2541 2623 3.07e-11 SMART
S_TKc 2656 2910 1.28e-71 SMART
Predicted Effect probably null
Transcript: ENSMUST00000089655
AA Change: Y1372*
SMART Domains Protein: ENSMUSP00000087084
Gene: ENSMUSG00000061751
AA Change: Y1372*

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
SEC14 38 177 2.22e-30 SMART
SPEC 191 307 5.32e-9 SMART
SPEC 313 415 1.19e-11 SMART
SPEC 418 533 1.83e0 SMART
SPEC 539 641 9.84e-13 SMART
SPEC 644 766 2.74e-2 SMART
SPEC 893 1003 1.85e-8 SMART
SPEC 1133 1235 4.7e-10 SMART
RhoGEF 1285 1455 3.6e-56 SMART
PH 1469 1582 5.24e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114947
AA Change: Y718*
SMART Domains Protein: ENSMUSP00000110597
Gene: ENSMUSG00000061751
AA Change: Y718*

DomainStartEndE-ValueType
SPEC 3 112 4.22e-3 SMART
internal_repeat_1 128 187 9.63e-6 PROSPERO
SPEC 239 349 1.85e-8 SMART
SPEC 479 581 4.7e-10 SMART
RhoGEF 631 801 3.6e-56 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114949
AA Change: Y722*
SMART Domains Protein: ENSMUSP00000110599
Gene: ENSMUSG00000061751
AA Change: Y722*

DomainStartEndE-ValueType
SPEC 3 125 2.74e-2 SMART
internal_repeat_1 141 204 2.9e-5 PROSPERO
SPEC 252 353 8.11e-14 SMART
SPEC 483 585 4.7e-10 SMART
RhoGEF 635 805 3.6e-56 SMART
PH 819 932 5.24e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114953
AA Change: Y731*
SMART Domains Protein: ENSMUSP00000110603
Gene: ENSMUSG00000061751
AA Change: Y731*

DomainStartEndE-ValueType
SPEC 3 125 2.74e-2 SMART
internal_repeat_1 141 204 4.18e-5 PROSPERO
coiled coil region 217 248 N/A INTRINSIC
SPEC 252 362 1.85e-8 SMART
SPEC 492 594 4.7e-10 SMART
RhoGEF 644 814 3.6e-56 SMART
PH 828 941 5.24e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114954
AA Change: Y731*
SMART Domains Protein: ENSMUSP00000110604
Gene: ENSMUSG00000061751
AA Change: Y731*

DomainStartEndE-ValueType
SPEC 3 125 2.74e-2 SMART
internal_repeat_1 141 204 4.18e-5 PROSPERO
coiled coil region 217 248 N/A INTRINSIC
SPEC 252 362 1.85e-8 SMART
SPEC 492 594 4.7e-10 SMART
RhoGEF 644 814 3.6e-56 SMART
PH 828 941 5.24e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114960
AA Change: Y1363*
SMART Domains Protein: ENSMUSP00000110611
Gene: ENSMUSG00000061751
AA Change: Y1363*

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
SEC14 38 177 2.22e-30 SMART
SPEC 191 307 5.32e-9 SMART
SPEC 313 415 1.19e-11 SMART
SPEC 418 533 1.83e0 SMART
SPEC 539 641 9.84e-13 SMART
SPEC 644 766 2.74e-2 SMART
SPEC 893 994 8.11e-14 SMART
SPEC 1124 1226 4.7e-10 SMART
RhoGEF 1276 1446 3.6e-56 SMART
PH 1460 1573 5.24e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000142817
AA Change: Y1340*
SMART Domains Protein: ENSMUSP00000116188
Gene: ENSMUSG00000061751
AA Change: Y1340*

DomainStartEndE-ValueType
SEC14 16 155 2.22e-30 SMART
SPEC 169 285 5.32e-9 SMART
SPEC 291 393 1.19e-11 SMART
SPEC 396 511 1.83e0 SMART
SPEC 517 619 9.84e-13 SMART
SPEC 622 744 2.74e-2 SMART
SPEC 871 972 8.11e-14 SMART
SPEC 1102 1204 4.7e-10 SMART
RhoGEF 1254 1424 3.6e-56 SMART
PH 1438 1551 5.24e-8 SMART
SH3 1618 1679 1.23e-7 SMART
RhoGEF 1900 2070 1.47e-52 SMART
PH 2090 2195 9.87e-4 SMART
SH3 2291 2352 2.78e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000151491
AA Change: Y1119*
SMART Domains Protein: ENSMUSP00000123416
Gene: ENSMUSG00000061751
AA Change: Y1119*

DomainStartEndE-ValueType
SEC14 26 165 2.22e-30 SMART
SPEC 179 295 5.32e-9 SMART
SPEC 301 403 1.19e-11 SMART
SPEC 640 750 1.85e-8 SMART
SPEC 880 982 4.7e-10 SMART
RhoGEF 1032 1202 3.6e-56 SMART
PH 1216 1329 5.24e-8 SMART
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntington's disease (HD), a neurodegenerative disorder characterized by loss of striatal neurons, is caused by an expansion of a polyglutamine tract in the HD protein huntingtin. This gene encodes a protein that interacts with the huntingtin-associated protein 1, which is a huntingtin binding protein that may function in vesicle trafficking. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele specific for isoform 7 exhibit decreased anxiety-related behavior, contextual conditioning, and synapse formation. Mice homozygous for another knock-out allele exhibit impaired AMPA-mediated synaptic currents and abnormal behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630089N07Rik T A 16: 98,065,824 I313F probably benign Het
Acot2 T A 12: 83,988,483 probably null Het
Agbl4 G T 4: 110,660,968 G152V unknown Het
Arap2 A G 5: 62,730,762 S414P probably damaging Het
C330021F23Rik T C 8: 3,584,160 V111A probably benign Het
Cep85l A C 10: 53,281,401 N735K probably damaging Het
Col12a1 T C 9: 79,678,551 S1209G possibly damaging Het
Dennd1b G A 1: 139,062,873 E192K probably damaging Het
Dpf1 C G 7: 29,311,681 N168K possibly damaging Het
Dync1li2 T A 8: 104,430,549 Y184F probably damaging Het
Epb41l2 A G 10: 25,443,829 T187A probably benign Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fndc3b G A 3: 27,461,743 T638I probably benign Het
Gm11564 A G 11: 99,815,598 V2A unknown Het
Gm13088 T A 4: 143,654,157 D432V possibly damaging Het
Gm3159 A G 14: 4,400,560 *206W probably null Het
Gm32742 A G 9: 51,159,823 probably null Het
Gm4847 G A 1: 166,642,250 H85Y probably damaging Het
Gprc5c A T 11: 114,864,532 D345V probably damaging Het
Kdm5a T C 6: 120,390,763 V473A probably damaging Het
Kidins220 T C 12: 24,982,351 C28R probably damaging Het
Klhl5 T C 5: 65,164,622 Y664H probably damaging Het
Krt17 A G 11: 100,260,872 S32P probably benign Het
Krt83 A G 15: 101,485,984 V424A possibly damaging Het
Lipo1 T C 19: 33,782,234 T201A possibly damaging Het
Map2 A G 1: 66,416,495 probably null Het
Megf10 C A 18: 57,277,659 T680N possibly damaging Het
Metap1d T A 2: 71,512,162 D178E probably damaging Het
Miip C T 4: 147,862,918 G236S probably benign Het
Mki67 A G 7: 135,698,194 S1704P probably damaging Het
Nr2f2 A G 7: 70,358,153 S194P probably benign Het
Nrsn2 T A 2: 152,376,551 probably benign Het
Ociad1 C T 5: 73,294,947 P27L probably damaging Het
Olfr1238 T A 2: 89,406,813 T89S possibly damaging Het
Olfr1339 T A 4: 118,734,685 I52N probably damaging Het
Patj A T 4: 98,546,983 M1L probably benign Het
Pcdhb2 A G 18: 37,295,393 I140V possibly damaging Het
Pla2g6 T C 15: 79,317,825 N49D probably benign Het
Pxdc1 T A 13: 34,652,371 N22I probably damaging Het
Rpgrip1l A G 8: 91,270,237 Y672H probably damaging Het
Safb2 T C 17: 56,566,327 R779G possibly damaging Het
Skiv2l C T 17: 34,844,418 G628S probably damaging Het
Smg5 A T 3: 88,349,432 Q299L probably damaging Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Sulf1 T C 1: 12,858,820 L864S probably benign Het
Tas1r1 A G 4: 152,034,755 V119A probably benign Het
Tasp1 T C 2: 140,008,785 N106S probably damaging Het
Tcf4 T A 18: 69,564,069 N156K probably benign Het
Trav14n-3 T A 14: 53,370,370 Y52* probably null Het
Ttn T C 2: 76,834,878 E11598G unknown Het
Unc80 A G 1: 66,503,714 I376V probably benign Het
Ybx3 T C 6: 131,368,516 E298G probably damaging Het
Yipf7 T C 5: 69,527,253 Y73C possibly damaging Het
Zdbf2 G A 1: 63,303,424 A321T possibly damaging Het
Zfp369 A G 13: 65,296,215 R391G probably benign Het
Zfp54 A G 17: 21,434,720 E492G probably damaging Het
Zfp971 A G 2: 178,031,610 T51A probably benign Het
Other mutations in Kalrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Kalrn APN 16 34175722 splice site probably benign
IGL01364:Kalrn APN 16 34262629 missense probably damaging 1.00
IGL01510:Kalrn APN 16 34235330 missense possibly damaging 0.52
IGL01664:Kalrn APN 16 34294161 missense probably damaging 1.00
IGL01934:Kalrn APN 16 34198512 splice site probably null
IGL02059:Kalrn APN 16 34252341 missense possibly damaging 0.95
IGL02102:Kalrn APN 16 34220222 missense probably damaging 1.00
IGL02306:Kalrn APN 16 34310527 missense probably damaging 0.97
IGL02328:Kalrn APN 16 34332224 missense probably damaging 0.98
IGL02532:Kalrn APN 16 34360846 missense probably damaging 1.00
IGL02685:Kalrn APN 16 34513959 nonsense probably null
IGL02696:Kalrn APN 16 34220114 missense probably damaging 1.00
IGL02708:Kalrn APN 16 34392050 missense probably damaging 1.00
IGL02937:Kalrn APN 16 34220130 nonsense probably null
IGL03188:Kalrn APN 16 34314192 missense probably benign 0.01
IGL03289:Kalrn APN 16 34385297 missense possibly damaging 0.90
IGL03408:Kalrn APN 16 34314176 missense probably damaging 0.99
breeze UTSW 16 34013675 missense
ethereal UTSW 16 33975435 utr 3 prime probably benign
Feather UTSW 16 34314209 missense probably damaging 0.99
Hidden UTSW 16 34027976 missense probably damaging 1.00
Soulful UTSW 16 34187484 nonsense probably null
G1Funyon:Kalrn UTSW 16 34357100 missense probably benign 0.05
PIT4498001:Kalrn UTSW 16 34031582 missense possibly damaging 0.81
R0019:Kalrn UTSW 16 34198514 splice site probably benign
R0043:Kalrn UTSW 16 34054906 missense probably damaging 1.00
R0052:Kalrn UTSW 16 34357171 missense probably damaging 1.00
R0066:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R0098:Kalrn UTSW 16 33975619 missense possibly damaging 0.89
R0098:Kalrn UTSW 16 33975619 missense possibly damaging 0.89
R0111:Kalrn UTSW 16 34031590 missense probably damaging 1.00
R0113:Kalrn UTSW 16 34049936 intron probably benign
R0183:Kalrn UTSW 16 34171379 splice site probably null
R0422:Kalrn UTSW 16 34314273 missense probably damaging 0.99
R0498:Kalrn UTSW 16 34054891 missense possibly damaging 0.61
R0614:Kalrn UTSW 16 33993670 splice site probably benign
R0656:Kalrn UTSW 16 34032467 missense probably damaging 1.00
R0671:Kalrn UTSW 16 34116408 missense probably benign 0.04
R0707:Kalrn UTSW 16 34010581 missense possibly damaging 0.88
R0709:Kalrn UTSW 16 34035554 missense probably damaging 1.00
R0834:Kalrn UTSW 16 34049919 missense possibly damaging 0.94
R0976:Kalrn UTSW 16 34385390 missense probably damaging 1.00
R1297:Kalrn UTSW 16 34016498 missense probably damaging 0.99
R1355:Kalrn UTSW 16 33975584 missense possibly damaging 0.74
R1370:Kalrn UTSW 16 33975584 missense possibly damaging 0.74
R1389:Kalrn UTSW 16 33988803 missense probably benign 0.01
R1398:Kalrn UTSW 16 34212820 missense probably damaging 1.00
R1427:Kalrn UTSW 16 33975754 missense probably damaging 1.00
R1458:Kalrn UTSW 16 34174487 missense probably damaging 1.00
R1470:Kalrn UTSW 16 34187471 missense probably damaging 1.00
R1470:Kalrn UTSW 16 34187471 missense probably damaging 1.00
R1557:Kalrn UTSW 16 34314278 missense possibly damaging 0.92
R1559:Kalrn UTSW 16 34010548 missense possibly damaging 0.92
R1654:Kalrn UTSW 16 33975738 missense probably damaging 1.00
R1703:Kalrn UTSW 16 34205326 missense probably damaging 1.00
R1759:Kalrn UTSW 16 34360950 missense probably damaging 0.97
R1764:Kalrn UTSW 16 34212873 missense probably damaging 1.00
R1824:Kalrn UTSW 16 34294215 missense probably damaging 1.00
R1845:Kalrn UTSW 16 34356961 missense probably damaging 0.99
R1850:Kalrn UTSW 16 33975923 missense probably damaging 0.98
R1921:Kalrn UTSW 16 34392093 missense probably benign 0.02
R1922:Kalrn UTSW 16 34392093 missense probably benign 0.02
R1970:Kalrn UTSW 16 33977524 critical splice donor site probably null
R1991:Kalrn UTSW 16 33975738 missense probably damaging 1.00
R1992:Kalrn UTSW 16 33975738 missense probably damaging 1.00
R2001:Kalrn UTSW 16 34028045 missense probably damaging 1.00
R2025:Kalrn UTSW 16 34189736 missense probably damaging 0.96
R2048:Kalrn UTSW 16 34252310 missense probably benign 0.18
R2076:Kalrn UTSW 16 34332143 missense probably benign 0.15
R2118:Kalrn UTSW 16 34332230 missense possibly damaging 0.84
R2136:Kalrn UTSW 16 34307724 missense possibly damaging 0.82
R2145:Kalrn UTSW 16 34009262 unclassified probably benign
R2193:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2195:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2234:Kalrn UTSW 16 34176262 splice site probably null
R2404:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2405:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2408:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2411:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2570:Kalrn UTSW 16 34310495 missense probably damaging 1.00
R2903:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2904:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2924:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R3411:Kalrn UTSW 16 34212272 missense probably benign 0.07
R3693:Kalrn UTSW 16 34357315 missense probably damaging 1.00
R3709:Kalrn UTSW 16 34392030 splice site probably null
R3788:Kalrn UTSW 16 34220240 missense probably damaging 1.00
R3833:Kalrn UTSW 16 34039889 nonsense probably null
R3871:Kalrn UTSW 16 34203856 splice site probably null
R3934:Kalrn UTSW 16 34310531 missense probably benign 0.34
R4033:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4056:Kalrn UTSW 16 34314209 missense probably damaging 0.99
R4057:Kalrn UTSW 16 34314209 missense probably damaging 0.99
R4303:Kalrn UTSW 16 34235391 missense probably damaging 1.00
R4402:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4444:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4482:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4487:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4558:Kalrn UTSW 16 33987208 missense possibly damaging 0.46
R4572:Kalrn UTSW 16 34392042 missense probably damaging 0.98
R4583:Kalrn UTSW 16 34235267 missense probably damaging 1.00
R4604:Kalrn UTSW 16 34513926 missense possibly damaging 0.46
R4620:Kalrn UTSW 16 34028705 missense probably damaging 0.99
R4651:Kalrn UTSW 16 34176391 missense probably damaging 1.00
R4703:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R4704:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R4705:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R4760:Kalrn UTSW 16 34198487 missense probably damaging 1.00
R4793:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4794:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4811:Kalrn UTSW 16 34356969 missense probably damaging 1.00
R4816:Kalrn UTSW 16 34514019 unclassified probably benign
R4888:Kalrn UTSW 16 34171330 missense probably damaging 1.00
R4952:Kalrn UTSW 16 34357415 splice site probably null
R5030:Kalrn UTSW 16 33975742 missense probably benign 0.00
R5045:Kalrn UTSW 16 34314352 nonsense probably null
R5117:Kalrn UTSW 16 34033601 critical splice acceptor site probably null
R5289:Kalrn UTSW 16 34252341 missense possibly damaging 0.95
R5426:Kalrn UTSW 16 34262653 missense probably damaging 1.00
R5432:Kalrn UTSW 16 34053622 missense probably damaging 1.00
R5611:Kalrn UTSW 16 34175780 missense probably damaging 1.00
R5629:Kalrn UTSW 16 34039934 missense possibly damaging 0.77
R5635:Kalrn UTSW 16 34014084 missense probably damaging 1.00
R5713:Kalrn UTSW 16 34016579 missense probably benign
R5716:Kalrn UTSW 16 33987176 missense probably benign 0.01
R5772:Kalrn UTSW 16 33975820 missense probably damaging 1.00
R5797:Kalrn UTSW 16 34212249 missense probably damaging 0.98
R5835:Kalrn UTSW 16 33987091 missense probably benign 0.28
R5895:Kalrn UTSW 16 33975435 utr 3 prime probably benign
R5924:Kalrn UTSW 16 34243833 missense probably damaging 1.00
R5999:Kalrn UTSW 16 34357343 missense probably damaging 1.00
R6010:Kalrn UTSW 16 34010580 missense probably benign 0.06
R6052:Kalrn UTSW 16 34360885 missense probably damaging 1.00
R6122:Kalrn UTSW 16 33985191 missense possibly damaging 0.82
R6128:Kalrn UTSW 16 34212885 missense probably damaging 0.99
R6136:Kalrn UTSW 16 34357111 missense probably damaging 1.00
R6178:Kalrn UTSW 16 34053639 missense possibly damaging 0.88
R6229:Kalrn UTSW 16 34055071 missense probably damaging 1.00
R6376:Kalrn UTSW 16 33975991 missense probably benign
R6397:Kalrn UTSW 16 33992985 missense probably damaging 1.00
R6429:Kalrn UTSW 16 34332164 missense possibly damaging 0.85
R6473:Kalrn UTSW 16 34205302 missense probably damaging 1.00
R6481:Kalrn UTSW 16 34360984 missense probably damaging 1.00
R6597:Kalrn UTSW 16 34182747 missense probably damaging 1.00
R6736:Kalrn UTSW 16 34217923 missense probably damaging 1.00
R6808:Kalrn UTSW 16 34027976 missense probably damaging 1.00
R6897:Kalrn UTSW 16 33975703 missense probably damaging 0.99
R6955:Kalrn UTSW 16 34220136 missense probably damaging 1.00
R7060:Kalrn UTSW 16 34357048 missense probably damaging 0.99
R7064:Kalrn UTSW 16 34217891 missense probably damaging 1.00
R7132:Kalrn UTSW 16 34256227 missense unknown
R7154:Kalrn UTSW 16 34212157 critical splice donor site probably null
R7181:Kalrn UTSW 16 34163077 missense probably benign 0.00
R7234:Kalrn UTSW 16 34176422 missense possibly damaging 0.63
R7235:Kalrn UTSW 16 34175761 missense probably benign 0.18
R7504:Kalrn UTSW 16 34256233 missense unknown
R7563:Kalrn UTSW 16 34392094 missense probably damaging 0.97
R7612:Kalrn UTSW 16 34314212 missense possibly damaging 0.68
R7772:Kalrn UTSW 16 34031582 missense probably benign 0.04
R7867:Kalrn UTSW 16 33989791 missense possibly damaging 0.94
R7869:Kalrn UTSW 16 33988847 missense probably damaging 0.98
R7914:Kalrn UTSW 16 34028752 missense probably benign
R8080:Kalrn UTSW 16 33975668 missense possibly damaging 0.83
R8147:Kalrn UTSW 16 34055044 missense probably benign
R8239:Kalrn UTSW 16 34049783 missense noncoding transcript
R8281:Kalrn UTSW 16 34035061 nonsense probably null
R8294:Kalrn UTSW 16 34033584 missense probably benign 0.12
R8301:Kalrn UTSW 16 34357100 missense probably benign 0.05
R8686:Kalrn UTSW 16 34360935 missense probably damaging 1.00
R8693:Kalrn UTSW 16 34034514 missense probably damaging 1.00
R8798:Kalrn UTSW 16 33982855 missense possibly damaging 0.65
R8878:Kalrn UTSW 16 34198460 missense probably benign 0.05
R8878:Kalrn UTSW 16 34205326 missense probably damaging 1.00
R8880:Kalrn UTSW 16 34217935 missense probably damaging 1.00
R8883:Kalrn UTSW 16 33993655 missense probably damaging 1.00
R8887:Kalrn UTSW 16 34227126 missense probably benign 0.22
R9048:Kalrn UTSW 16 34034484 missense possibly damaging 0.84
R9111:Kalrn UTSW 16 34361001 missense probably damaging 0.96
R9317:Kalrn UTSW 16 34013675 missense
R9424:Kalrn UTSW 16 33988818 missense probably benign 0.06
R9442:Kalrn UTSW 16 34095879 start codon destroyed probably null 0.56
R9445:Kalrn UTSW 16 33985230 missense probably benign 0.13
R9515:Kalrn UTSW 16 34034494 missense probably damaging 1.00
R9516:Kalrn UTSW 16 34034494 missense probably damaging 1.00
R9625:Kalrn UTSW 16 34028827 critical splice acceptor site probably null
R9645:Kalrn UTSW 16 34212213 missense probably benign 0.01
RF014:Kalrn UTSW 16 34039933 missense probably benign 0.01
Z1177:Kalrn UTSW 16 34035506 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGCAGACACTCATCGTAAAG -3'
(R):5'- TGCTGTACAACCCATGCTGG -3'

Sequencing Primer
(F):5'- CTCATCGTAAAGAAGAGGAGCGTCC -3'
(R):5'- GCTGTGTGTCAACTTAGCACAAG -3'
Posted On 2019-11-26