Incidental Mutation 'R7796:Zfp54'
ID600251
Institutional Source Beutler Lab
Gene Symbol Zfp54
Ensembl Gene ENSMUSG00000023882
Gene Namezinc finger protein 54
SynonymsKRAB10, Zfp-54, Zfp76, clone 18
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7796 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location21423227-21435640 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21434720 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 492 (E492G)
Ref Sequence ENSEMBL: ENSMUSP00000007884 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007884] [ENSMUST00000165230] [ENSMUST00000167749]
Predicted Effect probably damaging
Transcript: ENSMUST00000007884
AA Change: E492G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000007884
Gene: ENSMUSG00000023882
AA Change: E492G

DomainStartEndE-ValueType
KRAB 13 73 8.44e-22 SMART
ZnF_C2H2 211 233 1.69e-3 SMART
ZnF_C2H2 243 265 6.88e-4 SMART
ZnF_C2H2 271 293 2.12e-4 SMART
ZnF_C2H2 299 321 6.67e-2 SMART
ZnF_C2H2 327 349 7.67e-2 SMART
ZnF_C2H2 355 377 2.71e-2 SMART
ZnF_C2H2 383 403 6.24e0 SMART
ZnF_C2H2 411 433 5.99e-4 SMART
ZnF_C2H2 439 461 1.69e-3 SMART
ZnF_C2H2 467 489 2.43e-4 SMART
ZnF_C2H2 495 517 2.3e-5 SMART
ZnF_C2H2 523 545 8.22e-2 SMART
ZnF_C2H2 551 573 4.17e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165230
AA Change: E492G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132983
Gene: ENSMUSG00000023882
AA Change: E492G

DomainStartEndE-ValueType
KRAB 13 73 8.44e-22 SMART
ZnF_C2H2 211 233 1.69e-3 SMART
ZnF_C2H2 243 265 6.88e-4 SMART
ZnF_C2H2 271 293 2.12e-4 SMART
ZnF_C2H2 299 321 6.67e-2 SMART
ZnF_C2H2 327 349 7.67e-2 SMART
ZnF_C2H2 355 377 2.71e-2 SMART
ZnF_C2H2 383 403 6.24e0 SMART
ZnF_C2H2 411 433 5.99e-4 SMART
ZnF_C2H2 439 461 1.69e-3 SMART
ZnF_C2H2 467 489 2.43e-4 SMART
ZnF_C2H2 495 517 2.3e-5 SMART
ZnF_C2H2 523 545 8.22e-2 SMART
ZnF_C2H2 551 573 4.17e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167749
SMART Domains Protein: ENSMUSP00000127089
Gene: ENSMUSG00000023882

DomainStartEndE-ValueType
KRAB 13 73 8.44e-22 SMART
ZnF_C2H2 211 233 1.69e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630089N07Rik T A 16: 98,065,824 I313F probably benign Het
Acot2 T A 12: 83,988,483 probably null Het
Agbl4 G T 4: 110,660,968 G152V unknown Het
Arap2 A G 5: 62,730,762 S414P probably damaging Het
C330021F23Rik T C 8: 3,584,160 V111A probably benign Het
Cep85l A C 10: 53,281,401 N735K probably damaging Het
Col12a1 T C 9: 79,678,551 S1209G possibly damaging Het
Dennd1b G A 1: 139,062,873 E192K probably damaging Het
Dpf1 C G 7: 29,311,681 N168K possibly damaging Het
Dync1li2 T A 8: 104,430,549 Y184F probably damaging Het
Epb41l2 A G 10: 25,443,829 T187A probably benign Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fndc3b G A 3: 27,461,743 T638I probably benign Het
Gm11564 A G 11: 99,815,598 V2A unknown Het
Gm13088 T A 4: 143,654,157 D432V possibly damaging Het
Gm3159 A G 14: 4,400,560 *206W probably null Het
Gm32742 A G 9: 51,159,823 probably null Het
Gm4847 G A 1: 166,642,250 H85Y probably damaging Het
Gprc5c A T 11: 114,864,532 D345V probably damaging Het
Kalrn A T 16: 34,187,484 Y1363* probably null Het
Kdm5a T C 6: 120,390,763 V473A probably damaging Het
Kidins220 T C 12: 24,982,351 C28R probably damaging Het
Klhl5 T C 5: 65,164,622 Y664H probably damaging Het
Krt17 A G 11: 100,260,872 S32P probably benign Het
Krt83 A G 15: 101,485,984 V424A possibly damaging Het
Lipo1 T C 19: 33,782,234 T201A possibly damaging Het
Map2 A G 1: 66,416,495 probably null Het
Megf10 C A 18: 57,277,659 T680N possibly damaging Het
Metap1d T A 2: 71,512,162 D178E probably damaging Het
Miip C T 4: 147,862,918 G236S probably benign Het
Mki67 A G 7: 135,698,194 S1704P probably damaging Het
Nr2f2 A G 7: 70,358,153 S194P probably benign Het
Nrsn2 T A 2: 152,376,551 probably benign Het
Ociad1 C T 5: 73,294,947 P27L probably damaging Het
Olfr1238 T A 2: 89,406,813 T89S possibly damaging Het
Olfr1339 T A 4: 118,734,685 I52N probably damaging Het
Patj A T 4: 98,546,983 M1L probably benign Het
Pcdhb2 A G 18: 37,295,393 I140V possibly damaging Het
Pla2g6 T C 15: 79,317,825 N49D probably benign Het
Pxdc1 T A 13: 34,652,371 N22I probably damaging Het
Rpgrip1l A G 8: 91,270,237 Y672H probably damaging Het
Safb2 T C 17: 56,566,327 R779G possibly damaging Het
Skiv2l C T 17: 34,844,418 G628S probably damaging Het
Smg5 A T 3: 88,349,432 Q299L probably damaging Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Sulf1 T C 1: 12,858,820 L864S probably benign Het
Tas1r1 A G 4: 152,034,755 V119A probably benign Het
Tasp1 T C 2: 140,008,785 N106S probably damaging Het
Tcf4 T A 18: 69,564,069 N156K probably benign Het
Trav14n-3 T A 14: 53,370,370 Y52* probably null Het
Ttn T C 2: 76,834,878 E11598G unknown Het
Unc80 A G 1: 66,503,714 I376V probably benign Het
Ybx3 T C 6: 131,368,516 E298G probably damaging Het
Yipf7 T C 5: 69,527,253 Y73C possibly damaging Het
Zdbf2 G A 1: 63,303,424 A321T possibly damaging Het
Zfp369 A G 13: 65,296,215 R391G probably benign Het
Zfp971 A G 2: 178,031,610 T51A probably benign Het
Other mutations in Zfp54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Zfp54 APN 17 21433559 missense possibly damaging 0.62
IGL00425:Zfp54 APN 17 21430297 missense probably damaging 1.00
IGL02830:Zfp54 APN 17 21433456 missense probably damaging 1.00
IGL03037:Zfp54 APN 17 21430215 missense probably damaging 0.99
R1853:Zfp54 UTSW 17 21434142 nonsense probably null
R1855:Zfp54 UTSW 17 21434142 nonsense probably null
R1915:Zfp54 UTSW 17 21434152 missense probably benign
R3803:Zfp54 UTSW 17 21433552 missense possibly damaging 0.58
R4430:Zfp54 UTSW 17 21434960 missense probably damaging 0.98
R4724:Zfp54 UTSW 17 21433403 missense probably damaging 0.96
R4799:Zfp54 UTSW 17 21434140 missense probably damaging 1.00
R5197:Zfp54 UTSW 17 21434180 missense probably benign 0.12
R5400:Zfp54 UTSW 17 21433700 missense probably benign 0.05
R5422:Zfp54 UTSW 17 21434526 missense probably benign 0.00
R5566:Zfp54 UTSW 17 21433444 missense probably damaging 0.99
R6460:Zfp54 UTSW 17 21433742 missense probably benign
R6528:Zfp54 UTSW 17 21433474 nonsense probably null
R6876:Zfp54 UTSW 17 21433977 missense probably damaging 1.00
R7296:Zfp54 UTSW 17 21433582 missense probably benign 0.11
R7342:Zfp54 UTSW 17 21427752 start gained probably benign
R7660:Zfp54 UTSW 17 21434239 missense probably damaging 1.00
R7701:Zfp54 UTSW 17 21434095 missense probably benign 0.02
R8087:Zfp54 UTSW 17 21434998 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTCCTCAAGTCTCAGCAGA -3'
(R):5'- TGTTGGGATTTGAACACAGAGA -3'

Sequencing Primer
(F):5'- GCAGACATCAGAAAATCCATACTG -3'
(R):5'- TGGATATAGGATCTGTCACATTCC -3'
Posted On2019-11-26