Incidental Mutation 'R7796:Pcdhb2'
ID600254
Institutional Source Beutler Lab
Gene Symbol Pcdhb2
Ensembl Gene ENSMUSG00000051599
Gene Nameprotocadherin beta 2
SynonymsPcdhbB
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R7796 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location37294812-37297624 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37295393 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 140 (I140V)
Ref Sequence ENSEMBL: ENSMUSP00000057921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056522] [ENSMUST00000115661] [ENSMUST00000193137] [ENSMUST00000194544]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056522
AA Change: I140V

PolyPhen 2 Score 0.634 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000057921
Gene: ENSMUSG00000051599
AA Change: I140V

DomainStartEndE-ValueType
Pfam:Cadherin_2 32 114 5.2e-33 PFAM
CA 157 242 1.74e-19 SMART
CA 266 347 5.99e-23 SMART
CA 370 451 1.16e-20 SMART
CA 475 561 5.94e-27 SMART
CA 591 672 2.03e-11 SMART
Pfam:Cadherin_C_2 688 771 3.5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193137
SMART Domains Protein: ENSMUSP00000141439
Gene: ENSMUSG00000051599

DomainStartEndE-ValueType
CA 13 94 1.8e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630089N07Rik T A 16: 98,065,824 I313F probably benign Het
Acot2 T A 12: 83,988,483 probably null Het
Agbl4 G T 4: 110,660,968 G152V unknown Het
Arap2 A G 5: 62,730,762 S414P probably damaging Het
C330021F23Rik T C 8: 3,584,160 V111A probably benign Het
Cep85l A C 10: 53,281,401 N735K probably damaging Het
Col12a1 T C 9: 79,678,551 S1209G possibly damaging Het
Dennd1b G A 1: 139,062,873 E192K probably damaging Het
Dpf1 C G 7: 29,311,681 N168K possibly damaging Het
Dync1li2 T A 8: 104,430,549 Y184F probably damaging Het
Epb41l2 A G 10: 25,443,829 T187A probably benign Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fndc3b G A 3: 27,461,743 T638I probably benign Het
Gm11564 A G 11: 99,815,598 V2A unknown Het
Gm13088 T A 4: 143,654,157 D432V possibly damaging Het
Gm3159 A G 14: 4,400,560 *206W probably null Het
Gm32742 A G 9: 51,159,823 probably null Het
Gm4847 G A 1: 166,642,250 H85Y probably damaging Het
Gprc5c A T 11: 114,864,532 D345V probably damaging Het
Kalrn A T 16: 34,187,484 Y1363* probably null Het
Kdm5a T C 6: 120,390,763 V473A probably damaging Het
Kidins220 T C 12: 24,982,351 C28R probably damaging Het
Klhl5 T C 5: 65,164,622 Y664H probably damaging Het
Krt17 A G 11: 100,260,872 S32P probably benign Het
Krt83 A G 15: 101,485,984 V424A possibly damaging Het
Lipo1 T C 19: 33,782,234 T201A possibly damaging Het
Map2 A G 1: 66,416,495 probably null Het
Megf10 C A 18: 57,277,659 T680N possibly damaging Het
Metap1d T A 2: 71,512,162 D178E probably damaging Het
Miip C T 4: 147,862,918 G236S probably benign Het
Mki67 A G 7: 135,698,194 S1704P probably damaging Het
Nr2f2 A G 7: 70,358,153 S194P probably benign Het
Nrsn2 T A 2: 152,376,551 probably benign Het
Ociad1 C T 5: 73,294,947 P27L probably damaging Het
Olfr1238 T A 2: 89,406,813 T89S possibly damaging Het
Olfr1339 T A 4: 118,734,685 I52N probably damaging Het
Patj A T 4: 98,546,983 M1L probably benign Het
Pla2g6 T C 15: 79,317,825 N49D probably benign Het
Pxdc1 T A 13: 34,652,371 N22I probably damaging Het
Rpgrip1l A G 8: 91,270,237 Y672H probably damaging Het
Safb2 T C 17: 56,566,327 R779G possibly damaging Het
Skiv2l C T 17: 34,844,418 G628S probably damaging Het
Smg5 A T 3: 88,349,432 Q299L probably damaging Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Sulf1 T C 1: 12,858,820 L864S probably benign Het
Tas1r1 A G 4: 152,034,755 V119A probably benign Het
Tasp1 T C 2: 140,008,785 N106S probably damaging Het
Tcf4 T A 18: 69,564,069 N156K probably benign Het
Trav14n-3 T A 14: 53,370,370 Y52* probably null Het
Ttn T C 2: 76,834,878 E11598G unknown Het
Unc80 A G 1: 66,503,714 I376V probably benign Het
Ybx3 T C 6: 131,368,516 E298G probably damaging Het
Yipf7 T C 5: 69,527,253 Y73C possibly damaging Het
Zdbf2 G A 1: 63,303,424 A321T possibly damaging Het
Zfp369 A G 13: 65,296,215 R391G probably benign Het
Zfp54 A G 17: 21,434,720 E492G probably damaging Het
Zfp971 A G 2: 178,031,610 T51A probably benign Het
Other mutations in Pcdhb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Pcdhb2 APN 18 37296463 splice site probably null
IGL01538:Pcdhb2 APN 18 37295322 nonsense probably null
IGL01716:Pcdhb2 APN 18 37296738 missense probably damaging 0.99
IGL01747:Pcdhb2 APN 18 37296303 missense probably damaging 1.00
IGL01770:Pcdhb2 APN 18 37296303 missense probably damaging 1.00
IGL01999:Pcdhb2 APN 18 37296837 missense probably damaging 1.00
IGL02174:Pcdhb2 APN 18 37296498 missense probably damaging 1.00
IGL02325:Pcdhb2 APN 18 37296680 missense possibly damaging 0.91
IGL03148:Pcdhb2 APN 18 37296778 missense probably damaging 1.00
IGL03263:Pcdhb2 APN 18 37296006 missense probably damaging 1.00
R0158:Pcdhb2 UTSW 18 37297230 missense probably damaging 1.00
R0512:Pcdhb2 UTSW 18 37295979 missense probably damaging 1.00
R0656:Pcdhb2 UTSW 18 37295490 missense probably damaging 1.00
R0670:Pcdhb2 UTSW 18 37296648 missense probably damaging 1.00
R0698:Pcdhb2 UTSW 18 37297366 missense probably benign 0.00
R0825:Pcdhb2 UTSW 18 37295657 missense possibly damaging 0.61
R0827:Pcdhb2 UTSW 18 37295657 missense possibly damaging 0.61
R0862:Pcdhb2 UTSW 18 37295657 missense possibly damaging 0.61
R0863:Pcdhb2 UTSW 18 37295657 missense possibly damaging 0.61
R1344:Pcdhb2 UTSW 18 37295657 missense possibly damaging 0.61
R1440:Pcdhb2 UTSW 18 37296290 missense probably benign 0.22
R1826:Pcdhb2 UTSW 18 37295985 missense probably damaging 0.99
R1828:Pcdhb2 UTSW 18 37295985 missense probably damaging 0.99
R1869:Pcdhb2 UTSW 18 37297355 splice site probably null
R1871:Pcdhb2 UTSW 18 37297355 splice site probably null
R2292:Pcdhb2 UTSW 18 37297244 splice site probably null
R3743:Pcdhb2 UTSW 18 37296417 missense probably damaging 1.00
R4067:Pcdhb2 UTSW 18 37297314 splice site probably null
R4127:Pcdhb2 UTSW 18 37295541 missense probably damaging 0.97
R4402:Pcdhb2 UTSW 18 37295402 missense probably benign 0.05
R4579:Pcdhb2 UTSW 18 37296115 missense probably damaging 1.00
R4621:Pcdhb2 UTSW 18 37295927 missense probably benign 0.44
R4678:Pcdhb2 UTSW 18 37296207 missense probably damaging 1.00
R5143:Pcdhb2 UTSW 18 37296732 missense probably damaging 1.00
R5152:Pcdhb2 UTSW 18 37296126 missense probably damaging 0.97
R6552:Pcdhb2 UTSW 18 37295993 missense probably benign
R6908:Pcdhb2 UTSW 18 37296524 missense probably damaging 1.00
R6973:Pcdhb2 UTSW 18 37296363 missense probably benign 0.03
R7143:Pcdhb2 UTSW 18 37295881 missense probably benign 0.05
R7248:Pcdhb2 UTSW 18 37296494 missense probably damaging 1.00
R7586:Pcdhb2 UTSW 18 37295804 nonsense probably null
R7634:Pcdhb2 UTSW 18 37294947 intron probably benign
R7862:Pcdhb2 UTSW 18 37296060 missense probably benign 0.25
R8415:Pcdhb2 UTSW 18 37296057 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CCGCGAGTCATTTCCAAAGG -3'
(R):5'- CTTTGTCCAGAACCAGCTGTG -3'

Sequencing Primer
(F):5'- TCAATAGGCAAACAGGAGATTTGTTG -3'
(R):5'- CAGCTGTGGCAATACTGTGC -3'
Posted On2019-11-26