Incidental Mutation 'R7796:Megf10'
ID 600255
Institutional Source Beutler Lab
Gene Symbol Megf10
Ensembl Gene ENSMUSG00000024593
Gene Name multiple EGF-like-domains 10
Synonyms LOC240312, 3000002B06Rik
MMRRC Submission 045852-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.237) question?
Stock # R7796 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 57266162-57430539 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 57410731 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Asparagine at position 680 (T680N)
Ref Sequence ENSEMBL: ENSMUSP00000075174 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075770] [ENSMUST00000139892]
AlphaFold Q6DIB5
Predicted Effect possibly damaging
Transcript: ENSMUST00000075770
AA Change: T680N

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000075174
Gene: ENSMUSG00000024593
AA Change: T680N

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 108 136 9.41e-2 SMART
EGF_Lam 152 191 3.57e-2 SMART
EGF 190 222 5.79e-2 SMART
EGF 233 265 1.78e-2 SMART
EGF_Lam 281 320 7.58e-6 SMART
EGF 319 351 7.13e-2 SMART
EGF_Lam 368 409 9.05e-4 SMART
EGF 408 440 8.78e-2 SMART
EGF 451 483 2.85e-1 SMART
EGF 494 526 2.02e-1 SMART
EGF_Lam 542 581 1.04e-3 SMART
EGF 580 612 1.91e-2 SMART
EGF 623 657 2.16e1 SMART
EGF 668 700 2.48e-1 SMART
EGF 711 743 2.81e0 SMART
EGF_Lam 759 798 4.16e-3 SMART
EGF 797 829 1.73e0 SMART
transmembrane domain 856 878 N/A INTRINSIC
low complexity region 1014 1026 N/A INTRINSIC
low complexity region 1131 1146 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000139892
AA Change: T680N

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116814
Gene: ENSMUSG00000024593
AA Change: T680N

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 108 136 9.41e-2 SMART
EGF_Lam 152 191 3.57e-2 SMART
EGF 190 222 5.79e-2 SMART
EGF 233 265 1.78e-2 SMART
EGF_Lam 281 320 7.58e-6 SMART
EGF 319 351 7.13e-2 SMART
EGF_Lam 368 409 9.05e-4 SMART
EGF 408 440 8.78e-2 SMART
EGF 451 483 2.85e-1 SMART
EGF 494 526 2.02e-1 SMART
EGF_Lam 542 581 1.04e-3 SMART
EGF 580 612 1.91e-2 SMART
EGF 623 657 2.16e1 SMART
EGF 668 700 2.48e-1 SMART
EGF 711 743 2.81e0 SMART
EGF_Lam 759 798 4.16e-3 SMART
EGF 797 829 1.73e0 SMART
transmembrane domain 856 878 N/A INTRINSIC
low complexity region 1014 1026 N/A INTRINSIC
Meta Mutation Damage Score 0.2270 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the multiple epidermal growth factor-like domains protein family. The encoded protein plays a role in cell adhesion, motility and proliferation, and is a critical mediator of apoptotic cell phagocytosis as well as amyloid-beta peptide uptake in the brain. Expression of this gene may be associated with schizophrenia, and mutations in this gene are a cause of early-onset myopathy, areflexia, respiratory distress, and dysphagia (EMARDD) as well as congenital myopathy with minicores. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a targeted allele exhibit abnormal spacing of starburst amacrine cells and horizontal cells. Homozygotes for another targeted allele exhibit impaired phagocytosis of apoptotic cells by astrocytes. Mice heterozygous for this same allele exhibit mild disorganization of starburts amacrine cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630089N07Rik T A 16: 97,867,024 (GRCm39) I313F probably benign Het
Acot2 T A 12: 84,035,257 (GRCm39) probably null Het
Agbl4 G T 4: 110,518,165 (GRCm39) G152V unknown Het
Arap2 A G 5: 62,888,105 (GRCm39) S414P probably damaging Het
Cep85l A C 10: 53,157,497 (GRCm39) N735K probably damaging Het
Col12a1 T C 9: 79,585,833 (GRCm39) S1209G possibly damaging Het
Dennd1b G A 1: 138,990,611 (GRCm39) E192K probably damaging Het
Dpf1 C G 7: 29,011,106 (GRCm39) N168K possibly damaging Het
Dync1li2 T A 8: 105,157,181 (GRCm39) Y184F probably damaging Het
Epb41l2 A G 10: 25,319,727 (GRCm39) T187A probably benign Het
Fam50b G A 13: 34,931,084 (GRCm39) E187K possibly damaging Het
Fndc3b G A 3: 27,515,892 (GRCm39) T638I probably benign Het
Gm11564 A G 11: 99,706,424 (GRCm39) V2A unknown Het
Gm3159 A G 14: 4,400,560 (GRCm38) *206W probably null Het
Gm32742 A G 9: 51,071,123 (GRCm39) probably null Het
Gm4847 G A 1: 166,469,819 (GRCm39) H85Y probably damaging Het
Gprc5c A T 11: 114,755,358 (GRCm39) D345V probably damaging Het
Kalrn A T 16: 34,007,854 (GRCm39) Y1363* probably null Het
Kdm5a T C 6: 120,367,724 (GRCm39) V473A probably damaging Het
Kidins220 T C 12: 25,032,350 (GRCm39) C28R probably damaging Het
Klhl5 T C 5: 65,321,965 (GRCm39) Y664H probably damaging Het
Krt17 A G 11: 100,151,698 (GRCm39) S32P probably benign Het
Krt87 A G 15: 101,383,865 (GRCm39) V424A possibly damaging Het
Lipo3 T C 19: 33,759,634 (GRCm39) T201A possibly damaging Het
Map2 A G 1: 66,455,654 (GRCm39) probably null Het
Metap1d T A 2: 71,342,506 (GRCm39) D178E probably damaging Het
Miip C T 4: 147,947,375 (GRCm39) G236S probably benign Het
Mki67 A G 7: 135,299,923 (GRCm39) S1704P probably damaging Het
Nr2f2 A G 7: 70,007,901 (GRCm39) S194P probably benign Het
Nrsn2 T A 2: 152,218,471 (GRCm39) probably benign Het
Ociad1 C T 5: 73,452,290 (GRCm39) P27L probably damaging Het
Or13p5 T A 4: 118,591,882 (GRCm39) I52N probably damaging Het
Or4a39 T A 2: 89,237,157 (GRCm39) T89S possibly damaging Het
Patj A T 4: 98,435,220 (GRCm39) M1L probably benign Het
Pcdhb2 A G 18: 37,428,446 (GRCm39) I140V possibly damaging Het
Pla2g6 T C 15: 79,202,025 (GRCm39) N49D probably benign Het
Pramel22 T A 4: 143,380,727 (GRCm39) D432V possibly damaging Het
Pxdc1 T A 13: 34,836,354 (GRCm39) N22I probably damaging Het
Rpgrip1l A G 8: 91,996,865 (GRCm39) Y672H probably damaging Het
Rps23rg1 T C 8: 3,634,160 (GRCm39) V111A probably benign Het
Safb2 T C 17: 56,873,327 (GRCm39) R779G possibly damaging Het
Skic2 C T 17: 35,063,394 (GRCm39) G628S probably damaging Het
Smg5 A T 3: 88,256,739 (GRCm39) Q299L probably damaging Het
Sptbn2 C G 19: 4,799,040 (GRCm39) R2037G probably benign Het
Sulf1 T C 1: 12,929,044 (GRCm39) L864S probably benign Het
Tas1r1 A G 4: 152,119,212 (GRCm39) V119A probably benign Het
Tasp1 T C 2: 139,850,705 (GRCm39) N106S probably damaging Het
Tcf4 T A 18: 69,697,140 (GRCm39) N156K probably benign Het
Trav14n-3 T A 14: 53,607,827 (GRCm39) Y52* probably null Het
Ttn T C 2: 76,665,222 (GRCm39) E11598G unknown Het
Unc80 A G 1: 66,542,873 (GRCm39) I376V probably benign Het
Ybx3 T C 6: 131,345,479 (GRCm39) E298G probably damaging Het
Yipf7 T C 5: 69,684,596 (GRCm39) Y73C possibly damaging Het
Zdbf2 G A 1: 63,342,583 (GRCm39) A321T possibly damaging Het
Zfp369 A G 13: 65,444,029 (GRCm39) R391G probably benign Het
Zfp54 A G 17: 21,654,982 (GRCm39) E492G probably damaging Het
Zfp971 A G 2: 177,673,403 (GRCm39) T51A probably benign Het
Other mutations in Megf10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Megf10 APN 18 57,373,700 (GRCm39) missense probably damaging 1.00
IGL00736:Megf10 APN 18 57,425,782 (GRCm39) missense probably benign 0.35
IGL01631:Megf10 APN 18 57,392,869 (GRCm39) missense possibly damaging 0.61
IGL02488:Megf10 APN 18 57,425,704 (GRCm39) missense probably damaging 1.00
IGL02747:Megf10 APN 18 57,423,565 (GRCm39) missense probably benign 0.43
IGL03298:Megf10 APN 18 57,416,910 (GRCm39) nonsense probably null
deep UTSW 18 57,395,203 (GRCm39) missense probably damaging 1.00
megalodon UTSW 18 57,421,048 (GRCm39) nonsense probably null
sharkie UTSW 18 57,324,257 (GRCm39) nonsense probably null
IGL03046:Megf10 UTSW 18 57,421,055 (GRCm39) missense possibly damaging 0.95
PIT4696001:Megf10 UTSW 18 57,410,760 (GRCm39) missense probably damaging 1.00
R0020:Megf10 UTSW 18 57,420,965 (GRCm39) missense possibly damaging 0.81
R0020:Megf10 UTSW 18 57,420,965 (GRCm39) missense possibly damaging 0.81
R0115:Megf10 UTSW 18 57,392,874 (GRCm39) missense possibly damaging 0.67
R0455:Megf10 UTSW 18 57,386,054 (GRCm39) missense probably benign 0.34
R0602:Megf10 UTSW 18 57,395,172 (GRCm39) missense probably damaging 0.98
R0630:Megf10 UTSW 18 57,421,067 (GRCm39) missense probably benign 0.14
R0652:Megf10 UTSW 18 57,410,796 (GRCm39) missense probably benign 0.00
R0658:Megf10 UTSW 18 57,385,968 (GRCm39) missense probably benign 0.00
R0761:Megf10 UTSW 18 57,421,048 (GRCm39) nonsense probably null
R1013:Megf10 UTSW 18 57,394,291 (GRCm39) missense probably benign 0.00
R1130:Megf10 UTSW 18 57,395,078 (GRCm39) missense probably benign 0.06
R1451:Megf10 UTSW 18 57,385,931 (GRCm39) missense probably damaging 0.97
R1699:Megf10 UTSW 18 57,410,802 (GRCm39) splice site probably null
R1729:Megf10 UTSW 18 57,373,864 (GRCm39) critical splice donor site probably null
R1784:Megf10 UTSW 18 57,373,864 (GRCm39) critical splice donor site probably null
R1870:Megf10 UTSW 18 57,324,257 (GRCm39) nonsense probably null
R1961:Megf10 UTSW 18 57,345,426 (GRCm39) missense probably damaging 0.97
R2094:Megf10 UTSW 18 57,414,785 (GRCm39) nonsense probably null
R2213:Megf10 UTSW 18 57,421,081 (GRCm39) nonsense probably null
R2853:Megf10 UTSW 18 57,427,003 (GRCm39) missense probably damaging 1.00
R3772:Megf10 UTSW 18 57,416,934 (GRCm39) missense probably benign 0.39
R3774:Megf10 UTSW 18 57,410,177 (GRCm39) missense probably damaging 1.00
R3775:Megf10 UTSW 18 57,410,177 (GRCm39) missense probably damaging 1.00
R3776:Megf10 UTSW 18 57,410,177 (GRCm39) missense probably damaging 1.00
R3858:Megf10 UTSW 18 57,408,907 (GRCm39) splice site probably benign
R3911:Megf10 UTSW 18 57,422,465 (GRCm39) missense probably damaging 0.99
R3966:Megf10 UTSW 18 57,313,646 (GRCm39) missense probably damaging 1.00
R4043:Megf10 UTSW 18 57,392,870 (GRCm39) missense probably damaging 0.98
R4131:Megf10 UTSW 18 57,313,607 (GRCm39) missense probably damaging 1.00
R4598:Megf10 UTSW 18 57,420,884 (GRCm39) missense probably damaging 1.00
R4598:Megf10 UTSW 18 57,322,675 (GRCm39) critical splice donor site probably null
R4726:Megf10 UTSW 18 57,420,864 (GRCm39) missense probably benign 0.32
R4765:Megf10 UTSW 18 57,420,866 (GRCm39) missense possibly damaging 0.56
R4874:Megf10 UTSW 18 57,426,930 (GRCm39) missense probably benign 0.00
R4928:Megf10 UTSW 18 57,373,745 (GRCm39) missense probably benign
R5412:Megf10 UTSW 18 57,324,219 (GRCm39) missense probably damaging 0.99
R5901:Megf10 UTSW 18 57,410,180 (GRCm39) missense probably benign 0.11
R6015:Megf10 UTSW 18 57,386,100 (GRCm39) missense probably benign 0.01
R6036:Megf10 UTSW 18 57,375,799 (GRCm39) missense probably damaging 1.00
R6036:Megf10 UTSW 18 57,375,799 (GRCm39) missense probably damaging 1.00
R6041:Megf10 UTSW 18 57,313,621 (GRCm39) missense probably benign
R6369:Megf10 UTSW 18 57,394,259 (GRCm39) missense probably benign 0.06
R6479:Megf10 UTSW 18 57,379,642 (GRCm39) missense possibly damaging 0.76
R6489:Megf10 UTSW 18 57,424,879 (GRCm39) missense probably benign 0.01
R7228:Megf10 UTSW 18 57,322,661 (GRCm39) missense probably damaging 1.00
R7296:Megf10 UTSW 18 57,408,825 (GRCm39) missense probably damaging 1.00
R7437:Megf10 UTSW 18 57,395,203 (GRCm39) missense probably damaging 1.00
R7461:Megf10 UTSW 18 57,385,925 (GRCm39) missense probably damaging 0.98
R7488:Megf10 UTSW 18 57,324,187 (GRCm39) missense probably damaging 0.99
R7492:Megf10 UTSW 18 57,424,866 (GRCm39) missense probably benign 0.00
R7542:Megf10 UTSW 18 57,322,642 (GRCm39) missense probably benign 0.07
R7636:Megf10 UTSW 18 57,410,061 (GRCm39) missense possibly damaging 0.85
R7646:Megf10 UTSW 18 57,427,071 (GRCm39) unclassified probably benign
R7650:Megf10 UTSW 18 57,427,071 (GRCm39) unclassified probably benign
R7713:Megf10 UTSW 18 57,427,071 (GRCm39) unclassified probably benign
R7714:Megf10 UTSW 18 57,427,071 (GRCm39) unclassified probably benign
R7716:Megf10 UTSW 18 57,427,071 (GRCm39) unclassified probably benign
R7915:Megf10 UTSW 18 57,373,807 (GRCm39) missense probably benign 0.05
R8221:Megf10 UTSW 18 57,416,893 (GRCm39) missense probably benign 0.00
R8527:Megf10 UTSW 18 57,425,790 (GRCm39) missense probably benign 0.00
R8559:Megf10 UTSW 18 57,373,699 (GRCm39) missense probably damaging 1.00
R9117:Megf10 UTSW 18 57,392,773 (GRCm39) missense probably damaging 1.00
R9337:Megf10 UTSW 18 57,394,252 (GRCm39) nonsense probably null
R9481:Megf10 UTSW 18 57,395,090 (GRCm39) missense probably benign 0.38
R9644:Megf10 UTSW 18 57,375,773 (GRCm39) missense probably benign
RF003:Megf10 UTSW 18 57,427,099 (GRCm39) unclassified probably benign
Z1176:Megf10 UTSW 18 57,410,766 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATGTGTCTTCTCAACTGAAGGC -3'
(R):5'- TCCAGAGACTCACATCAATGTATC -3'

Sequencing Primer
(F):5'- CAGTGGGCAGCTGGGTG -3'
(R):5'- AGAGACTCACATCAATGTATCAGTAG -3'
Posted On 2019-11-26