Incidental Mutation 'R7796:Megf10'
ID600255
Institutional Source Beutler Lab
Gene Symbol Megf10
Ensembl Gene ENSMUSG00000024593
Gene Namemultiple EGF-like-domains 10
Synonyms3000002B06Rik, LOC240312
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.599) question?
Stock #R7796 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location57133090-57297467 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 57277659 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 680 (T680N)
Ref Sequence ENSEMBL: ENSMUSP00000075174 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075770] [ENSMUST00000139892]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075770
AA Change: T680N

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000075174
Gene: ENSMUSG00000024593
AA Change: T680N

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 108 136 9.41e-2 SMART
EGF_Lam 152 191 3.57e-2 SMART
EGF 190 222 5.79e-2 SMART
EGF 233 265 1.78e-2 SMART
EGF_Lam 281 320 7.58e-6 SMART
EGF 319 351 7.13e-2 SMART
EGF_Lam 368 409 9.05e-4 SMART
EGF 408 440 8.78e-2 SMART
EGF 451 483 2.85e-1 SMART
EGF 494 526 2.02e-1 SMART
EGF_Lam 542 581 1.04e-3 SMART
EGF 580 612 1.91e-2 SMART
EGF 623 657 2.16e1 SMART
EGF 668 700 2.48e-1 SMART
EGF 711 743 2.81e0 SMART
EGF_Lam 759 798 4.16e-3 SMART
EGF 797 829 1.73e0 SMART
transmembrane domain 856 878 N/A INTRINSIC
low complexity region 1014 1026 N/A INTRINSIC
low complexity region 1131 1146 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000139892
AA Change: T680N

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116814
Gene: ENSMUSG00000024593
AA Change: T680N

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 108 136 9.41e-2 SMART
EGF_Lam 152 191 3.57e-2 SMART
EGF 190 222 5.79e-2 SMART
EGF 233 265 1.78e-2 SMART
EGF_Lam 281 320 7.58e-6 SMART
EGF 319 351 7.13e-2 SMART
EGF_Lam 368 409 9.05e-4 SMART
EGF 408 440 8.78e-2 SMART
EGF 451 483 2.85e-1 SMART
EGF 494 526 2.02e-1 SMART
EGF_Lam 542 581 1.04e-3 SMART
EGF 580 612 1.91e-2 SMART
EGF 623 657 2.16e1 SMART
EGF 668 700 2.48e-1 SMART
EGF 711 743 2.81e0 SMART
EGF_Lam 759 798 4.16e-3 SMART
EGF 797 829 1.73e0 SMART
transmembrane domain 856 878 N/A INTRINSIC
low complexity region 1014 1026 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the multiple epidermal growth factor-like domains protein family. The encoded protein plays a role in cell adhesion, motility and proliferation, and is a critical mediator of apoptotic cell phagocytosis as well as amyloid-beta peptide uptake in the brain. Expression of this gene may be associated with schizophrenia, and mutations in this gene are a cause of early-onset myopathy, areflexia, respiratory distress, and dysphagia (EMARDD) as well as congenital myopathy with minicores. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a targeted allele exhibit abnormal spacing of starburst amacrine cells and horizontal cells. Homozygotes for another targeted allele exhibit impaired phagocytosis of apoptotic cells by astrocytes. Mice heterozygous for this same allele exhibit mild disorganization of starburts amacrine cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630089N07Rik T A 16: 98,065,824 I313F probably benign Het
Acot2 T A 12: 83,988,483 probably null Het
Agbl4 G T 4: 110,660,968 G152V unknown Het
Arap2 A G 5: 62,730,762 S414P probably damaging Het
C330021F23Rik T C 8: 3,584,160 V111A probably benign Het
Cep85l A C 10: 53,281,401 N735K probably damaging Het
Col12a1 T C 9: 79,678,551 S1209G possibly damaging Het
Dennd1b G A 1: 139,062,873 E192K probably damaging Het
Dpf1 C G 7: 29,311,681 N168K possibly damaging Het
Dync1li2 T A 8: 104,430,549 Y184F probably damaging Het
Epb41l2 A G 10: 25,443,829 T187A probably benign Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fndc3b G A 3: 27,461,743 T638I probably benign Het
Gm11564 A G 11: 99,815,598 V2A unknown Het
Gm13088 T A 4: 143,654,157 D432V possibly damaging Het
Gm3159 A G 14: 4,400,560 *206W probably null Het
Gm32742 A G 9: 51,159,823 probably null Het
Gm4847 G A 1: 166,642,250 H85Y probably damaging Het
Gprc5c A T 11: 114,864,532 D345V probably damaging Het
Kalrn A T 16: 34,187,484 Y1363* probably null Het
Kdm5a T C 6: 120,390,763 V473A probably damaging Het
Kidins220 T C 12: 24,982,351 C28R probably damaging Het
Klhl5 T C 5: 65,164,622 Y664H probably damaging Het
Krt17 A G 11: 100,260,872 S32P probably benign Het
Krt83 A G 15: 101,485,984 V424A possibly damaging Het
Lipo1 T C 19: 33,782,234 T201A possibly damaging Het
Map2 A G 1: 66,416,495 probably null Het
Metap1d T A 2: 71,512,162 D178E probably damaging Het
Miip C T 4: 147,862,918 G236S probably benign Het
Mki67 A G 7: 135,698,194 S1704P probably damaging Het
Nr2f2 A G 7: 70,358,153 S194P probably benign Het
Nrsn2 T A 2: 152,376,551 probably benign Het
Ociad1 C T 5: 73,294,947 P27L probably damaging Het
Olfr1238 T A 2: 89,406,813 T89S possibly damaging Het
Olfr1339 T A 4: 118,734,685 I52N probably damaging Het
Patj A T 4: 98,546,983 M1L probably benign Het
Pcdhb2 A G 18: 37,295,393 I140V possibly damaging Het
Pla2g6 T C 15: 79,317,825 N49D probably benign Het
Pxdc1 T A 13: 34,652,371 N22I probably damaging Het
Rpgrip1l A G 8: 91,270,237 Y672H probably damaging Het
Safb2 T C 17: 56,566,327 R779G possibly damaging Het
Skiv2l C T 17: 34,844,418 G628S probably damaging Het
Smg5 A T 3: 88,349,432 Q299L probably damaging Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Sulf1 T C 1: 12,858,820 L864S probably benign Het
Tas1r1 A G 4: 152,034,755 V119A probably benign Het
Tasp1 T C 2: 140,008,785 N106S probably damaging Het
Tcf4 T A 18: 69,564,069 N156K probably benign Het
Trav14n-3 T A 14: 53,370,370 Y52* probably null Het
Ttn T C 2: 76,834,878 E11598G unknown Het
Unc80 A G 1: 66,503,714 I376V probably benign Het
Ybx3 T C 6: 131,368,516 E298G probably damaging Het
Yipf7 T C 5: 69,527,253 Y73C possibly damaging Het
Zdbf2 G A 1: 63,303,424 A321T possibly damaging Het
Zfp369 A G 13: 65,296,215 R391G probably benign Het
Zfp54 A G 17: 21,434,720 E492G probably damaging Het
Zfp971 A G 2: 178,031,610 T51A probably benign Het
Other mutations in Megf10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Megf10 APN 18 57240628 missense probably damaging 1.00
IGL00736:Megf10 APN 18 57292710 missense probably benign 0.35
IGL01631:Megf10 APN 18 57259797 missense possibly damaging 0.61
IGL02488:Megf10 APN 18 57292632 missense probably damaging 1.00
IGL02747:Megf10 APN 18 57290493 missense probably benign 0.43
IGL03298:Megf10 APN 18 57283838 nonsense probably null
megalodon UTSW 18 57287976 nonsense probably null
sharkie UTSW 18 57191185 nonsense probably null
IGL03046:Megf10 UTSW 18 57287983 missense possibly damaging 0.95
PIT4696001:Megf10 UTSW 18 57277688 missense probably damaging 1.00
R0020:Megf10 UTSW 18 57287893 missense possibly damaging 0.81
R0020:Megf10 UTSW 18 57287893 missense possibly damaging 0.81
R0115:Megf10 UTSW 18 57259802 missense possibly damaging 0.67
R0455:Megf10 UTSW 18 57252982 missense probably benign 0.34
R0602:Megf10 UTSW 18 57262100 missense probably damaging 0.98
R0630:Megf10 UTSW 18 57287995 missense probably benign 0.14
R0652:Megf10 UTSW 18 57277724 missense probably benign 0.00
R0658:Megf10 UTSW 18 57252896 missense probably benign 0.00
R0761:Megf10 UTSW 18 57287976 nonsense probably null
R1013:Megf10 UTSW 18 57261219 missense probably benign 0.00
R1130:Megf10 UTSW 18 57262006 missense probably benign 0.06
R1451:Megf10 UTSW 18 57252859 missense probably damaging 0.97
R1699:Megf10 UTSW 18 57277730 splice site probably null
R1729:Megf10 UTSW 18 57240792 critical splice donor site probably null
R1784:Megf10 UTSW 18 57240792 critical splice donor site probably null
R1870:Megf10 UTSW 18 57191185 nonsense probably null
R1961:Megf10 UTSW 18 57212354 missense probably damaging 0.97
R2094:Megf10 UTSW 18 57281713 nonsense probably null
R2213:Megf10 UTSW 18 57288009 nonsense probably null
R2853:Megf10 UTSW 18 57293931 missense probably damaging 1.00
R3772:Megf10 UTSW 18 57283862 missense probably benign 0.39
R3774:Megf10 UTSW 18 57277105 missense probably damaging 1.00
R3775:Megf10 UTSW 18 57277105 missense probably damaging 1.00
R3776:Megf10 UTSW 18 57277105 missense probably damaging 1.00
R3858:Megf10 UTSW 18 57275835 splice site probably benign
R3911:Megf10 UTSW 18 57289393 missense probably damaging 0.99
R3966:Megf10 UTSW 18 57180574 missense probably damaging 1.00
R4043:Megf10 UTSW 18 57259798 missense probably damaging 0.98
R4131:Megf10 UTSW 18 57180535 missense probably damaging 1.00
R4598:Megf10 UTSW 18 57189603 critical splice donor site probably null
R4598:Megf10 UTSW 18 57287812 missense probably damaging 1.00
R4726:Megf10 UTSW 18 57287792 missense probably benign 0.32
R4765:Megf10 UTSW 18 57287794 missense possibly damaging 0.56
R4874:Megf10 UTSW 18 57293858 missense probably benign 0.00
R4928:Megf10 UTSW 18 57240673 missense probably benign
R5412:Megf10 UTSW 18 57191147 missense probably damaging 0.99
R5901:Megf10 UTSW 18 57277108 missense probably benign 0.11
R6015:Megf10 UTSW 18 57253028 missense probably benign 0.01
R6036:Megf10 UTSW 18 57242727 missense probably damaging 1.00
R6036:Megf10 UTSW 18 57242727 missense probably damaging 1.00
R6041:Megf10 UTSW 18 57180549 missense probably benign
R6369:Megf10 UTSW 18 57261187 missense probably benign 0.06
R6479:Megf10 UTSW 18 57246570 missense possibly damaging 0.76
R6489:Megf10 UTSW 18 57291807 missense probably benign 0.01
R7228:Megf10 UTSW 18 57189589 missense probably damaging 1.00
R7296:Megf10 UTSW 18 57275753 missense probably damaging 1.00
R7437:Megf10 UTSW 18 57262131 missense probably damaging 1.00
R7461:Megf10 UTSW 18 57252853 missense probably damaging 0.98
R7488:Megf10 UTSW 18 57191115 missense probably damaging 0.99
R7492:Megf10 UTSW 18 57291794 missense probably benign 0.00
R7542:Megf10 UTSW 18 57189570 missense probably benign 0.07
R7636:Megf10 UTSW 18 57276989 missense possibly damaging 0.85
R7646:Megf10 UTSW 18 57293999 unclassified probably benign
R7650:Megf10 UTSW 18 57293999 unclassified probably benign
R7713:Megf10 UTSW 18 57293999 unclassified probably benign
R7714:Megf10 UTSW 18 57293999 unclassified probably benign
R7716:Megf10 UTSW 18 57293999 unclassified probably benign
R7915:Megf10 UTSW 18 57240735 missense probably benign 0.05
R8221:Megf10 UTSW 18 57283821 missense probably benign 0.00
RF003:Megf10 UTSW 18 57294027 unclassified probably benign
Z1176:Megf10 UTSW 18 57277694 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATGTGTCTTCTCAACTGAAGGC -3'
(R):5'- TCCAGAGACTCACATCAATGTATC -3'

Sequencing Primer
(F):5'- CAGTGGGCAGCTGGGTG -3'
(R):5'- AGAGACTCACATCAATGTATCAGTAG -3'
Posted On2019-11-26