Incidental Mutation 'R7796:Tcf4'
ID600256
Institutional Source Beutler Lab
Gene Symbol Tcf4
Ensembl Gene ENSMUSG00000053477
Gene Nametranscription factor 4
SynonymsMITF-2B, ITF-2, MITF-2A, ME2, SEF2-1, 5730422P05Rik, ASP-I2, SEF-2, bHLHb19, TFE, E2.2, ITF-2b, E2-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7796 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location69343356-69689079 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 69564069 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 156 (N156K)
Ref Sequence ENSEMBL: ENSMUSP00000067318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066717] [ENSMUST00000078486] [ENSMUST00000114980] [ENSMUST00000114982] [ENSMUST00000114985] [ENSMUST00000128706] [ENSMUST00000200703] [ENSMUST00000200813] [ENSMUST00000200862] [ENSMUST00000200966] [ENSMUST00000201094] [ENSMUST00000201124] [ENSMUST00000201181] [ENSMUST00000201205] [ENSMUST00000201235] [ENSMUST00000201288] [ENSMUST00000201299] [ENSMUST00000201410] [ENSMUST00000201537] [ENSMUST00000201627] [ENSMUST00000201631] [ENSMUST00000201781] [ENSMUST00000202057] [ENSMUST00000202074] [ENSMUST00000202116] [ENSMUST00000202350] [ENSMUST00000202354] [ENSMUST00000202435] [ENSMUST00000202458] [ENSMUST00000202477] [ENSMUST00000202610] [ENSMUST00000202674] [ENSMUST00000202765] [ENSMUST00000202772] [ENSMUST00000202937] [ENSMUST00000203002] [ENSMUST00000207214] [ENSMUST00000209174]
Predicted Effect probably benign
Transcript: ENSMUST00000066717
AA Change: N156K

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000067318
Gene: ENSMUSG00000053477
AA Change: N156K

DomainStartEndE-ValueType
low complexity region 244 252 N/A INTRINSIC
low complexity region 358 369 N/A INTRINSIC
low complexity region 452 464 N/A INTRINSIC
low complexity region 488 501 N/A INTRINSIC
low complexity region 524 542 N/A INTRINSIC
low complexity region 546 564 N/A INTRINSIC
HLH 595 648 3.57e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000078486
AA Change: N134K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000077577
Gene: ENSMUSG00000053477
AA Change: N134K

DomainStartEndE-ValueType
low complexity region 222 230 N/A INTRINSIC
low complexity region 336 347 N/A INTRINSIC
low complexity region 430 442 N/A INTRINSIC
low complexity region 466 479 N/A INTRINSIC
low complexity region 502 520 N/A INTRINSIC
low complexity region 524 542 N/A INTRINSIC
HLH 573 626 3.57e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114980
AA Change: N134K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000110631
Gene: ENSMUSG00000053477
AA Change: N134K

DomainStartEndE-ValueType
low complexity region 222 230 N/A INTRINSIC
low complexity region 336 347 N/A INTRINSIC
low complexity region 430 442 N/A INTRINSIC
low complexity region 466 479 N/A INTRINSIC
low complexity region 502 520 N/A INTRINSIC
low complexity region 524 545 N/A INTRINSIC
HLH 569 622 3.57e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114982
AA Change: N134K

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000110633
Gene: ENSMUSG00000053477
AA Change: N134K

DomainStartEndE-ValueType
low complexity region 222 230 N/A INTRINSIC
low complexity region 336 347 N/A INTRINSIC
low complexity region 430 442 N/A INTRINSIC
low complexity region 466 479 N/A INTRINSIC
low complexity region 502 520 N/A INTRINSIC
low complexity region 524 545 N/A INTRINSIC
HLH 569 622 3.57e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114985
AA Change: N134K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000110636
Gene: ENSMUSG00000053477
AA Change: N134K

DomainStartEndE-ValueType
low complexity region 222 230 N/A INTRINSIC
low complexity region 336 347 N/A INTRINSIC
low complexity region 430 442 N/A INTRINSIC
low complexity region 466 479 N/A INTRINSIC
low complexity region 502 520 N/A INTRINSIC
low complexity region 524 542 N/A INTRINSIC
HLH 573 626 3.57e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128706
AA Change: N110K

PolyPhen 2 Score 0.361 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000200703
SMART Domains Protein: ENSMUSP00000144583
Gene: ENSMUSG00000053477

DomainStartEndE-ValueType
low complexity region 7 15 N/A INTRINSIC
low complexity region 121 132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200813
AA Change: N5K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000144397
Gene: ENSMUSG00000053477
AA Change: N5K

DomainStartEndE-ValueType
low complexity region 93 101 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200862
AA Change: N5K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000144338
Gene: ENSMUSG00000053477
AA Change: N5K

DomainStartEndE-ValueType
low complexity region 93 101 N/A INTRINSIC
low complexity region 207 218 N/A INTRINSIC
low complexity region 301 313 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200966
AA Change: N5K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000144045
Gene: ENSMUSG00000053477
AA Change: N5K

DomainStartEndE-ValueType
low complexity region 93 101 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201094
AA Change: N5K

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000144169
Gene: ENSMUSG00000053477
AA Change: N5K

DomainStartEndE-ValueType
low complexity region 93 101 N/A INTRINSIC
low complexity region 207 218 N/A INTRINSIC
low complexity region 301 313 N/A INTRINSIC
low complexity region 337 350 N/A INTRINSIC
low complexity region 373 391 N/A INTRINSIC
low complexity region 395 416 N/A INTRINSIC
HLH 440 493 1.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201124
AA Change: N57K

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000144080
Gene: ENSMUSG00000053477
AA Change: N57K

DomainStartEndE-ValueType
low complexity region 145 153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201181
AA Change: N5K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000144376
Gene: ENSMUSG00000053477
AA Change: N5K

DomainStartEndE-ValueType
low complexity region 93 101 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201205
AA Change: N5K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000144273
Gene: ENSMUSG00000053477
AA Change: N5K

DomainStartEndE-ValueType
low complexity region 93 101 N/A INTRINSIC
low complexity region 207 218 N/A INTRINSIC
low complexity region 301 313 N/A INTRINSIC
low complexity region 337 350 N/A INTRINSIC
low complexity region 373 391 N/A INTRINSIC
low complexity region 395 413 N/A INTRINSIC
HLH 444 497 1.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201235
AA Change: N110K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000201288
AA Change: N134K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000201299
AA Change: N110K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000201410
AA Change: N5K

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000143950
Gene: ENSMUSG00000053477
AA Change: N5K

DomainStartEndE-ValueType
low complexity region 93 101 N/A INTRINSIC
low complexity region 207 218 N/A INTRINSIC
low complexity region 301 313 N/A INTRINSIC
low complexity region 337 350 N/A INTRINSIC
low complexity region 373 391 N/A INTRINSIC
low complexity region 395 416 N/A INTRINSIC
HLH 440 493 1.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201537
AA Change: N110K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000201627
AA Change: N5K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000144649
Gene: ENSMUSG00000053477
AA Change: N5K

DomainStartEndE-ValueType
low complexity region 93 101 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201631
AA Change: N110K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000144285
Gene: ENSMUSG00000053477
AA Change: N110K

DomainStartEndE-ValueType
low complexity region 198 206 N/A INTRINSIC
low complexity region 312 323 N/A INTRINSIC
low complexity region 406 418 N/A INTRINSIC
low complexity region 442 455 N/A INTRINSIC
low complexity region 478 496 N/A INTRINSIC
low complexity region 500 521 N/A INTRINSIC
HLH 545 598 1.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201781
AA Change: N110K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000144209
Gene: ENSMUSG00000053477
AA Change: N110K

DomainStartEndE-ValueType
low complexity region 198 206 N/A INTRINSIC
low complexity region 312 323 N/A INTRINSIC
low complexity region 406 418 N/A INTRINSIC
low complexity region 442 455 N/A INTRINSIC
low complexity region 478 496 N/A INTRINSIC
low complexity region 500 518 N/A INTRINSIC
HLH 549 602 1.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202057
AA Change: N5K

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000144647
Gene: ENSMUSG00000053477
AA Change: N5K

DomainStartEndE-ValueType
low complexity region 93 101 N/A INTRINSIC
low complexity region 207 218 N/A INTRINSIC
low complexity region 301 313 N/A INTRINSIC
low complexity region 337 350 N/A INTRINSIC
low complexity region 373 391 N/A INTRINSIC
low complexity region 395 416 N/A INTRINSIC
HLH 440 493 1.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202074
AA Change: N109K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000202116
AA Change: N134K

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000144512
Gene: ENSMUSG00000053477
AA Change: N134K

DomainStartEndE-ValueType
low complexity region 222 230 N/A INTRINSIC
low complexity region 336 347 N/A INTRINSIC
low complexity region 430 442 N/A INTRINSIC
low complexity region 466 479 N/A INTRINSIC
low complexity region 502 520 N/A INTRINSIC
low complexity region 524 545 N/A INTRINSIC
HLH 569 622 3.57e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202350
AA Change: N5K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000144154
Gene: ENSMUSG00000053477
AA Change: N5K

DomainStartEndE-ValueType
low complexity region 93 101 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202354
AA Change: N110K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000144646
Gene: ENSMUSG00000053477
AA Change: N110K

DomainStartEndE-ValueType
low complexity region 198 206 N/A INTRINSIC
low complexity region 312 323 N/A INTRINSIC
low complexity region 405 417 N/A INTRINSIC
low complexity region 441 454 N/A INTRINSIC
low complexity region 477 495 N/A INTRINSIC
low complexity region 499 520 N/A INTRINSIC
HLH 544 597 1.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202435
AA Change: N110K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000144407
Gene: ENSMUSG00000053477
AA Change: N110K

DomainStartEndE-ValueType
low complexity region 198 206 N/A INTRINSIC
low complexity region 312 323 N/A INTRINSIC
low complexity region 406 418 N/A INTRINSIC
low complexity region 442 455 N/A INTRINSIC
low complexity region 478 496 N/A INTRINSIC
low complexity region 500 518 N/A INTRINSIC
HLH 549 602 1.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202458
AA Change: N55K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000143875
Gene: ENSMUSG00000053477
AA Change: N55K

DomainStartEndE-ValueType
low complexity region 143 151 N/A INTRINSIC
low complexity region 257 268 N/A INTRINSIC
low complexity region 351 363 N/A INTRINSIC
low complexity region 387 400 N/A INTRINSIC
low complexity region 423 441 N/A INTRINSIC
low complexity region 445 466 N/A INTRINSIC
HLH 490 543 1.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202477
AA Change: N5K

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000144219
Gene: ENSMUSG00000053477
AA Change: N5K

DomainStartEndE-ValueType
low complexity region 93 101 N/A INTRINSIC
low complexity region 207 218 N/A INTRINSIC
low complexity region 301 313 N/A INTRINSIC
low complexity region 337 350 N/A INTRINSIC
low complexity region 373 391 N/A INTRINSIC
low complexity region 395 416 N/A INTRINSIC
HLH 440 493 1.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202610
SMART Domains Protein: ENSMUSP00000144670
Gene: ENSMUSG00000053477

DomainStartEndE-ValueType
low complexity region 162 170 N/A INTRINSIC
low complexity region 276 287 N/A INTRINSIC
low complexity region 370 382 N/A INTRINSIC
low complexity region 406 419 N/A INTRINSIC
low complexity region 442 460 N/A INTRINSIC
low complexity region 464 482 N/A INTRINSIC
HLH 513 566 1.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202674
AA Change: N109K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000144221
Gene: ENSMUSG00000053477
AA Change: N109K

DomainStartEndE-ValueType
low complexity region 197 205 N/A INTRINSIC
low complexity region 311 322 N/A INTRINSIC
low complexity region 405 417 N/A INTRINSIC
low complexity region 441 454 N/A INTRINSIC
low complexity region 477 495 N/A INTRINSIC
low complexity region 499 520 N/A INTRINSIC
HLH 544 597 1.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202765
AA Change: N5K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000144332
Gene: ENSMUSG00000053477
AA Change: N5K

DomainStartEndE-ValueType
low complexity region 93 101 N/A INTRINSIC
low complexity region 207 218 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202772
SMART Domains Protein: ENSMUSP00000143987
Gene: ENSMUSG00000053477

DomainStartEndE-ValueType
low complexity region 162 170 N/A INTRINSIC
low complexity region 276 287 N/A INTRINSIC
low complexity region 370 382 N/A INTRINSIC
low complexity region 406 419 N/A INTRINSIC
low complexity region 442 460 N/A INTRINSIC
low complexity region 464 485 N/A INTRINSIC
HLH 509 562 1.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202937
AA Change: N5K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000143857
Gene: ENSMUSG00000053477
AA Change: N5K

DomainStartEndE-ValueType
low complexity region 93 101 N/A INTRINSIC
low complexity region 207 218 N/A INTRINSIC
low complexity region 301 313 N/A INTRINSIC
low complexity region 337 350 N/A INTRINSIC
low complexity region 373 391 N/A INTRINSIC
low complexity region 395 413 N/A INTRINSIC
HLH 444 497 1.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203002
AA Change: N134K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000207214
AA Change: N5K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000209174
AA Change: N5K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes transcription factor 4, a basic helix-loop-helix transcription factor. The encoded protein recognizes an Ephrussi-box ('E-box') binding site ('CANNTG') - a motif first identified in immunoglobulin enhancers. This gene is broadly expressed, and may play an important role in nervous system development. Defects in this gene are a cause of Pitt-Hopkins syndrome. In addition, an intronic CTG repeat normally numbering 10-37 repeat units can expand to >50 repeat units and cause Fuchs endothelial corneal dystrophy. Multiple alternatively spliced transcript variants that encode different proteins have been described. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a null allele show a partial block in early thymopoiesis, increased double-negative T cell count, and increased sensitivity to anti-CD3 induced apoptosis. Homozygotes for another null allele show neonatal or postnatal lethality, reduced pro-B cell number, and abnormal pontine nuclei. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630089N07Rik T A 16: 98,065,824 I313F probably benign Het
Acot2 T A 12: 83,988,483 probably null Het
Agbl4 G T 4: 110,660,968 G152V unknown Het
Arap2 A G 5: 62,730,762 S414P probably damaging Het
C330021F23Rik T C 8: 3,584,160 V111A probably benign Het
Cep85l A C 10: 53,281,401 N735K probably damaging Het
Col12a1 T C 9: 79,678,551 S1209G possibly damaging Het
Dennd1b G A 1: 139,062,873 E192K probably damaging Het
Dpf1 C G 7: 29,311,681 N168K possibly damaging Het
Dync1li2 T A 8: 104,430,549 Y184F probably damaging Het
Epb41l2 A G 10: 25,443,829 T187A probably benign Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fndc3b G A 3: 27,461,743 T638I probably benign Het
Gm11564 A G 11: 99,815,598 V2A unknown Het
Gm13088 T A 4: 143,654,157 D432V possibly damaging Het
Gm3159 A G 14: 4,400,560 *206W probably null Het
Gm32742 A G 9: 51,159,823 probably null Het
Gm4847 G A 1: 166,642,250 H85Y probably damaging Het
Gprc5c A T 11: 114,864,532 D345V probably damaging Het
Kalrn A T 16: 34,187,484 Y1363* probably null Het
Kdm5a T C 6: 120,390,763 V473A probably damaging Het
Kidins220 T C 12: 24,982,351 C28R probably damaging Het
Klhl5 T C 5: 65,164,622 Y664H probably damaging Het
Krt17 A G 11: 100,260,872 S32P probably benign Het
Krt83 A G 15: 101,485,984 V424A possibly damaging Het
Lipo1 T C 19: 33,782,234 T201A possibly damaging Het
Map2 A G 1: 66,416,495 probably null Het
Megf10 C A 18: 57,277,659 T680N possibly damaging Het
Metap1d T A 2: 71,512,162 D178E probably damaging Het
Miip C T 4: 147,862,918 G236S probably benign Het
Mki67 A G 7: 135,698,194 S1704P probably damaging Het
Nr2f2 A G 7: 70,358,153 S194P probably benign Het
Nrsn2 T A 2: 152,376,551 probably benign Het
Ociad1 C T 5: 73,294,947 P27L probably damaging Het
Olfr1238 T A 2: 89,406,813 T89S possibly damaging Het
Olfr1339 T A 4: 118,734,685 I52N probably damaging Het
Patj A T 4: 98,546,983 M1L probably benign Het
Pcdhb2 A G 18: 37,295,393 I140V possibly damaging Het
Pla2g6 T C 15: 79,317,825 N49D probably benign Het
Pxdc1 T A 13: 34,652,371 N22I probably damaging Het
Rpgrip1l A G 8: 91,270,237 Y672H probably damaging Het
Safb2 T C 17: 56,566,327 R779G possibly damaging Het
Skiv2l C T 17: 34,844,418 G628S probably damaging Het
Smg5 A T 3: 88,349,432 Q299L probably damaging Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Sulf1 T C 1: 12,858,820 L864S probably benign Het
Tas1r1 A G 4: 152,034,755 V119A probably benign Het
Tasp1 T C 2: 140,008,785 N106S probably damaging Het
Trav14n-3 T A 14: 53,370,370 Y52* probably null Het
Ttn T C 2: 76,834,878 E11598G unknown Het
Unc80 A G 1: 66,503,714 I376V probably benign Het
Ybx3 T C 6: 131,368,516 E298G probably damaging Het
Yipf7 T C 5: 69,527,253 Y73C possibly damaging Het
Zdbf2 G A 1: 63,303,424 A321T possibly damaging Het
Zfp369 A G 13: 65,296,215 R391G probably benign Het
Zfp54 A G 17: 21,434,720 E492G probably damaging Het
Zfp971 A G 2: 178,031,610 T51A probably benign Het
Other mutations in Tcf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Tcf4 APN 18 69655019 missense probably damaging 1.00
IGL02131:Tcf4 APN 18 69564626 splice site probably benign
IGL02221:Tcf4 APN 18 69347367 missense probably damaging 1.00
IGL02420:Tcf4 APN 18 69564139 missense probably damaging 1.00
IGL02560:Tcf4 APN 18 69643022 unclassified probably benign
IGL02637:Tcf4 APN 18 69347350 missense probably damaging 1.00
IGL03056:Tcf4 APN 18 69651212 splice site probably benign
R0374:Tcf4 UTSW 18 69681812 splice site probably benign
R1265:Tcf4 UTSW 18 69642932 missense possibly damaging 0.93
R1739:Tcf4 UTSW 18 69642970 missense probably damaging 1.00
R1794:Tcf4 UTSW 18 69657853 missense probably benign 0.44
R4703:Tcf4 UTSW 18 69657910 missense probably damaging 1.00
R4735:Tcf4 UTSW 18 69564155 missense possibly damaging 0.59
R4993:Tcf4 UTSW 18 69681769 missense probably damaging 1.00
R5191:Tcf4 UTSW 18 69642883 missense probably damaging 1.00
R5318:Tcf4 UTSW 18 69465430 missense probably benign
R5634:Tcf4 UTSW 18 69636847 missense possibly damaging 0.88
R6337:Tcf4 UTSW 18 69633580 missense probably damaging 1.00
R6658:Tcf4 UTSW 18 69657802 missense probably null 1.00
R6868:Tcf4 UTSW 18 69657650 splice site probably null
R6907:Tcf4 UTSW 18 69652413 missense probably damaging 1.00
R7170:Tcf4 UTSW 18 69633578 missense probably damaging 1.00
R7235:Tcf4 UTSW 18 69657795 missense probably damaging 1.00
R7431:Tcf4 UTSW 18 69347178 splice site probably null
R7589:Tcf4 UTSW 18 69682819 makesense probably null
R7606:Tcf4 UTSW 18 69642983 missense probably damaging 0.99
R8193:Tcf4 UTSW 18 69500923 start gained probably benign
R8461:Tcf4 UTSW 18 69465430 missense probably benign
Z1176:Tcf4 UTSW 18 69593380 intron probably benign
Predicted Primers PCR Primer
(F):5'- AGAAAACCCAGTTTGATGGTAGC -3'
(R):5'- TGTCCTTTGGGCCAAAGTAGG -3'

Sequencing Primer
(F):5'- AAACCCAGTTTGATGGTAGCTTCTC -3'
(R):5'- CCTTTGGGCCAAAGTAGGGGTAG -3'
Posted On2019-11-26