Incidental Mutation 'R7796:Lipo1'
ID600258
Institutional Source Beutler Lab
Gene Symbol Lipo1
Ensembl Gene ENSMUSG00000024766
Gene Namelipase, member O1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R7796 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location33517740-33590308 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33782234 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 201 (T201A)
Ref Sequence ENSEMBL: ENSMUSP00000136249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178735]
Predicted Effect
SMART Domains Protein: ENSMUSP00000118385
Gene: ENSMUSG00000079342
AA Change: T204A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Abhydro_lipase 37 99 2.8e-21 PFAM
Pfam:Hydrolase_4 76 239 4.3e-8 PFAM
Pfam:Abhydrolase_1 80 219 2.2e-17 PFAM
Pfam:Abhydrolase_5 80 233 8.7e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000178735
AA Change: T201A

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000136249
Gene: ENSMUSG00000079342
AA Change: T201A

DomainStartEndE-ValueType
Pfam:Abhydro_lipase 33 95 1.3e-20 PFAM
Pfam:Hydrolase_4 72 231 3.5e-8 PFAM
Pfam:Abhydrolase_5 76 370 3.7e-10 PFAM
Pfam:Abhydrolase_1 76 376 6.8e-21 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630089N07Rik T A 16: 98,065,824 I313F probably benign Het
Acot2 T A 12: 83,988,483 probably null Het
Agbl4 G T 4: 110,660,968 G152V unknown Het
Arap2 A G 5: 62,730,762 S414P probably damaging Het
C330021F23Rik T C 8: 3,584,160 V111A probably benign Het
Cep85l A C 10: 53,281,401 N735K probably damaging Het
Col12a1 T C 9: 79,678,551 S1209G possibly damaging Het
Dennd1b G A 1: 139,062,873 E192K probably damaging Het
Dpf1 C G 7: 29,311,681 N168K possibly damaging Het
Dync1li2 T A 8: 104,430,549 Y184F probably damaging Het
Epb41l2 A G 10: 25,443,829 T187A probably benign Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fndc3b G A 3: 27,461,743 T638I probably benign Het
Gm11564 A G 11: 99,815,598 V2A unknown Het
Gm13088 T A 4: 143,654,157 D432V possibly damaging Het
Gm3159 A G 14: 4,400,560 *206W probably null Het
Gm32742 A G 9: 51,159,823 probably null Het
Gm4847 G A 1: 166,642,250 H85Y probably damaging Het
Gprc5c A T 11: 114,864,532 D345V probably damaging Het
Kalrn A T 16: 34,187,484 Y1363* probably null Het
Kdm5a T C 6: 120,390,763 V473A probably damaging Het
Kidins220 T C 12: 24,982,351 C28R probably damaging Het
Klhl5 T C 5: 65,164,622 Y664H probably damaging Het
Krt17 A G 11: 100,260,872 S32P probably benign Het
Krt83 A G 15: 101,485,984 V424A possibly damaging Het
Map2 A G 1: 66,416,495 probably null Het
Megf10 C A 18: 57,277,659 T680N possibly damaging Het
Metap1d T A 2: 71,512,162 D178E probably damaging Het
Miip C T 4: 147,862,918 G236S probably benign Het
Mki67 A G 7: 135,698,194 S1704P probably damaging Het
Nr2f2 A G 7: 70,358,153 S194P probably benign Het
Nrsn2 T A 2: 152,376,551 probably benign Het
Ociad1 C T 5: 73,294,947 P27L probably damaging Het
Olfr1238 T A 2: 89,406,813 T89S possibly damaging Het
Olfr1339 T A 4: 118,734,685 I52N probably damaging Het
Patj A T 4: 98,546,983 M1L probably benign Het
Pcdhb2 A G 18: 37,295,393 I140V possibly damaging Het
Pla2g6 T C 15: 79,317,825 N49D probably benign Het
Pxdc1 T A 13: 34,652,371 N22I probably damaging Het
Rpgrip1l A G 8: 91,270,237 Y672H probably damaging Het
Safb2 T C 17: 56,566,327 R779G possibly damaging Het
Skiv2l C T 17: 34,844,418 G628S probably damaging Het
Smg5 A T 3: 88,349,432 Q299L probably damaging Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Sulf1 T C 1: 12,858,820 L864S probably benign Het
Tas1r1 A G 4: 152,034,755 V119A probably benign Het
Tasp1 T C 2: 140,008,785 N106S probably damaging Het
Tcf4 T A 18: 69,564,069 N156K probably benign Het
Trav14n-3 T A 14: 53,370,370 Y52* probably null Het
Ttn T C 2: 76,834,878 E11598G unknown Het
Unc80 A G 1: 66,503,714 I376V probably benign Het
Ybx3 T C 6: 131,368,516 E298G probably damaging Het
Yipf7 T C 5: 69,527,253 Y73C possibly damaging Het
Zdbf2 G A 1: 63,303,424 A321T possibly damaging Het
Zfp369 A G 13: 65,296,215 R391G probably benign Het
Zfp54 A G 17: 21,434,720 E492G probably damaging Het
Zfp971 A G 2: 178,031,610 T51A probably benign Het
Other mutations in Lipo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01521:Lipo1 APN 19 33785683 missense probably damaging 1.00
IGL01916:Lipo1 APN 19 33784782 missense probably damaging 1.00
IGL03005:Lipo1 APN 19 33785736 missense possibly damaging 0.65
R0646:Lipo1 UTSW 19 33784769 nonsense probably null
R1704:Lipo1 UTSW 19 33780343 missense possibly damaging 0.87
R1772:Lipo1 UTSW 19 33787421 missense probably benign 0.45
R1862:Lipo1 UTSW 19 33784692 missense probably damaging 1.00
R1863:Lipo1 UTSW 19 33784692 missense probably damaging 1.00
R3801:Lipo1 UTSW 19 33784857 missense probably damaging 0.99
R3802:Lipo1 UTSW 19 33784857 missense probably damaging 0.99
R3803:Lipo1 UTSW 19 33784857 missense probably damaging 0.99
R4020:Lipo1 UTSW 19 33787404 missense probably benign 0.00
R4648:Lipo1 UTSW 19 33783460 missense probably damaging 1.00
R4775:Lipo1 UTSW 19 33780395 missense probably damaging 1.00
R4787:Lipo1 UTSW 19 33780349 missense probably benign 0.00
R4830:Lipo1 UTSW 19 33776587 missense probably damaging 0.99
R4951:Lipo1 UTSW 19 33782221 missense probably benign 0.01
R5799:Lipo1 UTSW 19 33777693 intron probably benign
R5853:Lipo1 UTSW 19 33782230 missense probably benign 0.37
R6235:Lipo1 UTSW 19 33783563 missense probably damaging 0.96
R6296:Lipo1 UTSW 19 33780337 missense probably benign 0.10
R6913:Lipo1 UTSW 19 33780305 missense probably benign 0.00
R7672:Lipo1 UTSW 19 33780385 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- CTTTCTGCAGCCATCAAGGG -3'
(R):5'- TTCAGGAACGAGTTTAAATGTCTGC -3'

Sequencing Primer
(F):5'- CTGCAGCCATCAAGGGAGGAG -3'
(R):5'- CGAGTTTAAATGTCTGCAAAAAGC -3'
Posted On2019-11-26