Mutagenetix > Incidental Mutation

Incidental Mutation 'R7797:Zc3h6'

600263

Institutional Source

Beutler Lab

Gene Symbol

Zc3h6

Ensembl Gene

ENSMUSG00000042851

Gene Name

zinc finger CCCH type containing 6

Synonyms

MMRRC Submission

045853-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.214) question?

Stock #

R7797 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

128967402-129018563 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 129015635 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000105949 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110320]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000110320

SMART Domains

Protein: ENSMUSP00000105949
Gene: ENSMUSG00000042851

Domain	Start	End	E-Value	Type
low complexity region	8	25	N/A	INTRINSIC
coiled coil region	30	71	N/A	INTRINSIC
low complexity region	74	88	N/A	INTRINSIC
low complexity region	177	192	N/A	INTRINSIC
ZnF_C3H1	271	296	1.72e-4	SMART
ZnF_C3H1	300	325	2.51e-6	SMART
ZnF_C3H1	326	349	5.24e0	SMART
coiled coil region	351	383	N/A	INTRINSIC
low complexity region	385	400	N/A	INTRINSIC
low complexity region	493	509	N/A	INTRINSIC
low complexity region	698	707	N/A	INTRINSIC
low complexity region	784	798	N/A	INTRINSIC
low complexity region	815	829	N/A	INTRINSIC
low complexity region	876	890	N/A	INTRINSIC

Meta Mutation Damage Score

0.9490

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

100% (68/68)

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	T	C	17: 33,067,690	D46G	probably damaging	Het
9230110C19Rik	G	T	9: 8,027,129	P136Q	possibly damaging	Het
Abca8b	A	G	11: 109,971,683		probably null	Het
Adam3	T	G	8: 24,694,644	N535T	probably damaging	Het
Adamts4	A	G	1: 171,257,818	K679E	probably damaging	Het
Arnt	G	A	3: 95,480,261		probably null	Het
Asah2	A	G	19: 32,022,361	F321L	probably damaging	Het
Asb15	T	C	6: 24,562,506	S156P	probably damaging	Het
Baiap2l1	A	C	5: 144,318,950	S65A	probably damaging	Het
Bend7	T	G	2: 4,749,644	M186R	probably damaging	Het
Blnk	T	C	19: 40,959,788	K146E	possibly damaging	Het
Cd19	A	G	7: 126,413,508	W238R	probably damaging	Het
Cd44	T	A	2: 102,848,734	N241I	probably benign	Het
Cdh23	T	C	10: 60,385,194	E1257G	probably benign	Het
Cntnap5c	T	C	17: 58,359,275	V1100A	probably benign	Het
Cul7	T	C	17: 46,658,642	V945A	possibly damaging	Het
Dock2	C	T	11: 34,282,652	C1116Y	probably damaging	Het
Ehbp1	T	C	11: 22,096,109	M547V	possibly damaging	Het
Fam50b	G	A	13: 34,747,101	E187K	possibly damaging	Het
Gm5346	T	A	8: 43,626,374	E271V	probably benign	Het
Grhl3	C	G	4: 135,559,105	K88N	possibly damaging	Het
Hbb-y	T	A	7: 103,851,881	Y146F	probably damaging	Het
Hivep2	T	C	10: 14,130,103	V815A	probably benign	Het
Hoxa7	T	A	6: 52,215,890	I173F	probably damaging	Het
Igkv1-110	T	G	6: 68,270,993	S29A	probably benign	Het
Jade2	A	G	11: 51,817,299	S696P	probably benign	Het
Kif1b	T	A	4: 149,237,387	Q1025L	probably benign	Het
Kif2c	A	T	4: 117,171,743	C241S	probably benign	Het
Kmt2d	G	T	15: 98,864,406	H400N	probably benign	Het
Krt35	T	A	11: 100,094,887	N174Y	probably damaging	Het
Ldlrad1	G	A	4: 107,209,491	A8T	probably benign	Het
Magi3	A	G	3: 104,051,302	V489A	probably damaging	Het
Mapk7	T	C	11: 61,489,415	E739G	possibly damaging	Het
Mcidas	G	A	13: 112,998,987	G315S	probably damaging	Het
Mdga1	C	T	17: 29,842,840		probably null	Het
Megf8	G	A	7: 25,334,597	R607H	probably damaging	Het
Met	T	A	6: 17,533,953	N634K	probably damaging	Het
Miip	C	T	4: 147,862,918	G236S	probably benign	Het
Mmp11	G	T	10: 75,923,480	T107K		Het
Mroh2b	A	C	15: 4,949,105	N1378H	probably benign	Het
Naa15	G	A	3: 51,448,610	C322Y	probably damaging	Het
Naip1	T	A	13: 100,444,478	Y87F	probably damaging	Het
Ngrn	A	G	7: 80,264,437	D112G	probably benign	Het
Osbpl1a	C	A	18: 12,882,264	C369F	probably damaging	Het
Pcnx2	G	C	8: 125,785,348	D1406E	possibly damaging	Het
Pold1	G	A	7: 44,541,789	P206L	probably benign	Het
Psen1	A	G	12: 83,699,622	S20G	probably benign	Het
Ptpn23	C	T	9: 110,393,807	D61N	possibly damaging	Het
Rbfox3	A	T	11: 118,496,484	L268Q	possibly damaging	Het
Rbm22	A	G	18: 60,561,272	T26A	probably damaging	Het
Rpgrip1	G	A	14: 52,133,820	R332Q	possibly damaging	Het
Rrm2b	A	T	15: 37,927,261	L347*	probably null	Het
Rsf1	A	T	7: 97,661,485	D474V		Het
Ryr2	C	T	13: 11,801,180	R640Q	probably damaging	Het
Sec16b	A	G	1: 157,561,675	E691G	unknown	Het
Sept1	A	T	7: 127,214,765	V365E	unknown	Het
Tlk2	A	G	11: 105,210,618	H114R	probably benign	Het
Tmem200a	A	G	10: 25,993,966	I135T	possibly damaging	Het
Tpst2	T	A	5: 112,307,916	V107E	probably damaging	Het
Trim30a	A	T	7: 104,411,200	D456E	possibly damaging	Het
Ttll3	T	C	6: 113,394,777	V45A	possibly damaging	Het
Ulk2	A	G	11: 61,782,102	Y889H	probably benign	Het
Umodl1	A	G	17: 30,959,151	S34G	probably benign	Het
Vmn1r67	A	G	7: 10,446,976	I56V	probably benign	Het
Vmn2r120	C	T	17: 57,508,874	G827E	probably damaging	Het

Other mutations in Zc3h6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01732:Zc3h6	APN	2	129011875	missense	probably damaging	1.00
IGL01880:Zc3h6	APN	2	129017378	missense	probably damaging	0.99
IGL02160:Zc3h6	APN	2	128997685	missense	probably benign	0.02
IGL02161:Zc3h6	APN	2	128993226	missense	possibly damaging	0.90
IGL02202:Zc3h6	APN	2	129016581	missense	probably damaging	1.00
IGL02547:Zc3h6	APN	2	129015611	missense	probably benign	0.00
IGL02973:Zc3h6	APN	2	128997795	missense	probably damaging	0.98
BB001:Zc3h6	UTSW	2	129015480	missense	possibly damaging	0.52
BB011:Zc3h6	UTSW	2	129015480	missense	possibly damaging	0.52
R0336:Zc3h6	UTSW	2	129015412	missense	possibly damaging	0.81
R0420:Zc3h6	UTSW	2	129014827	missense	probably benign	0.00
R0538:Zc3h6	UTSW	2	129017223	missense	possibly damaging	0.75
R0944:Zc3h6	UTSW	2	129006816	missense	probably damaging	1.00
R1151:Zc3h6	UTSW	2	129017136	missense	probably benign	0.00
R1528:Zc3h6	UTSW	2	129017069	missense	probably benign	0.01
R1698:Zc3h6	UTSW	2	129017358	missense	probably benign
R1712:Zc3h6	UTSW	2	129016734	missense	probably damaging	1.00
R1913:Zc3h6	UTSW	2	129016620	missense	probably damaging	1.00
R1926:Zc3h6	UTSW	2	128997795	missense	probably damaging	0.98
R2030:Zc3h6	UTSW	2	129006086	missense	probably damaging	1.00
R2051:Zc3h6	UTSW	2	129015618	missense	possibly damaging	0.55
R2133:Zc3h6	UTSW	2	128967830	missense	possibly damaging	0.53
R2273:Zc3h6	UTSW	2	129014709	missense	probably benign	0.01
R2328:Zc3h6	UTSW	2	128993202	missense	possibly damaging	0.85
R2862:Zc3h6	UTSW	2	129015460	missense	probably benign	0.43
R2899:Zc3h6	UTSW	2	129002232	missense	probably benign	0.00
R3711:Zc3h6	UTSW	2	129017331	missense	probably benign	0.00
R3743:Zc3h6	UTSW	2	128997792	missense	probably damaging	1.00
R3893:Zc3h6	UTSW	2	129016140	missense	probably damaging	1.00
R4748:Zc3h6	UTSW	2	129002240	missense	probably damaging	1.00
R5025:Zc3h6	UTSW	2	129010433	missense	possibly damaging	0.87
R5026:Zc3h6	UTSW	2	129017309	missense	probably benign	0.00
R5125:Zc3h6	UTSW	2	129014479	missense	possibly damaging	0.93
R5373:Zc3h6	UTSW	2	129002156	missense	possibly damaging	0.75
R5374:Zc3h6	UTSW	2	129002156	missense	possibly damaging	0.75
R5703:Zc3h6	UTSW	2	128993452	intron	probably benign
R5802:Zc3h6	UTSW	2	129015559	missense	possibly damaging	0.56
R5876:Zc3h6	UTSW	2	128993277	missense	probably benign	0.29
R5879:Zc3h6	UTSW	2	128997776	splice site	probably null
R5950:Zc3h6	UTSW	2	128997790	nonsense	probably null
R6031:Zc3h6	UTSW	2	128967812	missense	possibly damaging	0.85
R6031:Zc3h6	UTSW	2	128967812	missense	possibly damaging	0.85
R6781:Zc3h6	UTSW	2	129015421	missense	probably damaging	0.99
R7323:Zc3h6	UTSW	2	128993411	missense	unknown
R7340:Zc3h6	UTSW	2	128993190	missense	possibly damaging	0.90
R7572:Zc3h6	UTSW	2	129017252	missense	probably benign	0.02
R7576:Zc3h6	UTSW	2	129014553	missense	probably damaging	1.00
R7924:Zc3h6	UTSW	2	129015480	missense	possibly damaging	0.52
R8048:Zc3h6	UTSW	2	129017014	missense	probably benign	0.30
R8877:Zc3h6	UTSW	2	129014399	nonsense	probably null
R9076:Zc3h6	UTSW	2	129017176	nonsense	probably null
R9577:Zc3h6	UTSW	2	129016182	missense
R9687:Zc3h6	UTSW	2	129017361	missense	probably damaging	1.00
R9745:Zc3h6	UTSW	2	129017235	missense	probably benign	0.08
Z1176:Zc3h6	UTSW	2	129016221	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- ATTGCTCGTGACACAGCACAC -3'
(R):5'- GTACACGCACAGTTAAGGTAAATTG -3'

Sequencing Primer
(F):5'- TGACACAGCACACCTTGGGAG -3'
(R):5'- CACATGAAGTTTTAGGAAGAGTACTC -3'

Posted On

2019-11-26