Incidental Mutation 'R7797:Kif2c'
ID600268
Institutional Source Beutler Lab
Gene Symbol Kif2c
Ensembl Gene ENSMUSG00000028678
Gene Namekinesin family member 2C
Synonyms4930402F02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7797 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location117159639-117182639 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 117171743 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 241 (C241S)
Ref Sequence ENSEMBL: ENSMUSP00000064261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065896] [ENSMUST00000106436] [ENSMUST00000153953]
PDB Structure
The Crystal Structure of the Minimal Functional Domain of the Microtubule Destabilizer KIF2C Complexed with Mg-ADP [X-RAY DIFFRACTION]
The Crystal Structure of the Minimal Functional Domain of the Microtubule Destabilizer KIF2C Complexed with Mg-AMPPNP [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000065896
AA Change: C241S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000064261
Gene: ENSMUSG00000028678
AA Change: C241S

DomainStartEndE-ValueType
low complexity region 192 205 N/A INTRINSIC
KISc 252 590 1.04e-131 SMART
coiled coil region 615 647 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106436
AA Change: C190S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102044
Gene: ENSMUSG00000028678
AA Change: C190S

DomainStartEndE-ValueType
low complexity region 141 154 N/A INTRINSIC
KISc 201 539 1.04e-131 SMART
coiled coil region 564 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153953
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a kinesin-like protein that functions as a microtubule-dependent molecular motor. The encoded protein can depolymerize microtubules at the plus end, thereby promoting mitotic chromosome segregation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T C 17: 33,067,690 D46G probably damaging Het
9230110C19Rik G T 9: 8,027,129 P136Q possibly damaging Het
Abca8b A G 11: 109,971,683 probably null Het
Adam3 T G 8: 24,694,644 N535T probably damaging Het
Adamts4 A G 1: 171,257,818 K679E probably damaging Het
Arnt G A 3: 95,480,261 probably null Het
Asah2 A G 19: 32,022,361 F321L probably damaging Het
Asb15 T C 6: 24,562,506 S156P probably damaging Het
Baiap2l1 A C 5: 144,318,950 S65A probably damaging Het
Bend7 T G 2: 4,749,644 M186R probably damaging Het
Blnk T C 19: 40,959,788 K146E possibly damaging Het
Cd19 A G 7: 126,413,508 W238R probably damaging Het
Cd44 T A 2: 102,848,734 N241I probably benign Het
Cdh23 T C 10: 60,385,194 E1257G probably benign Het
Cntnap5c T C 17: 58,359,275 V1100A probably benign Het
Cul7 T C 17: 46,658,642 V945A possibly damaging Het
Dock2 C T 11: 34,282,652 C1116Y probably damaging Het
Ehbp1 T C 11: 22,096,109 M547V possibly damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Gm5346 T A 8: 43,626,374 E271V probably benign Het
Grhl3 C G 4: 135,559,105 K88N possibly damaging Het
Hbb-y T A 7: 103,851,881 Y146F probably damaging Het
Hivep2 T C 10: 14,130,103 V815A probably benign Het
Hoxa7 T A 6: 52,215,890 I173F probably damaging Het
Igkv1-110 T G 6: 68,270,993 S29A probably benign Het
Jade2 A G 11: 51,817,299 S696P probably benign Het
Kif1b T A 4: 149,237,387 Q1025L probably benign Het
Kmt2d G T 15: 98,864,406 H400N probably benign Het
Krt35 T A 11: 100,094,887 N174Y probably damaging Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Magi3 A G 3: 104,051,302 V489A probably damaging Het
Mapk7 T C 11: 61,489,415 E739G possibly damaging Het
Mcidas G A 13: 112,998,987 G315S probably damaging Het
Mdga1 C T 17: 29,842,840 probably null Het
Megf8 G A 7: 25,334,597 R607H probably damaging Het
Met T A 6: 17,533,953 N634K probably damaging Het
Miip C T 4: 147,862,918 G236S probably benign Het
Mmp11 G T 10: 75,923,480 T107K Het
Mroh2b A C 15: 4,949,105 N1378H probably benign Het
Naa15 G A 3: 51,448,610 C322Y probably damaging Het
Naip1 T A 13: 100,444,478 Y87F probably damaging Het
Ngrn A G 7: 80,264,437 D112G probably benign Het
Osbpl1a C A 18: 12,882,264 C369F probably damaging Het
Pcnx2 G C 8: 125,785,348 D1406E possibly damaging Het
Pold1 G A 7: 44,541,789 P206L probably benign Het
Psen1 A G 12: 83,699,622 S20G probably benign Het
Ptpn23 C T 9: 110,393,807 D61N possibly damaging Het
Rbfox3 A T 11: 118,496,484 L268Q possibly damaging Het
Rbm22 A G 18: 60,561,272 T26A probably damaging Het
Rpgrip1 G A 14: 52,133,820 R332Q possibly damaging Het
Rrm2b A T 15: 37,927,261 L347* probably null Het
Rsf1 A T 7: 97,661,485 D474V Het
Ryr2 C T 13: 11,801,180 R640Q probably damaging Het
Sec16b A G 1: 157,561,675 E691G unknown Het
Sept1 A T 7: 127,214,765 V365E unknown Het
Tlk2 A G 11: 105,210,618 H114R probably benign Het
Tmem200a A G 10: 25,993,966 I135T possibly damaging Het
Tpst2 T A 5: 112,307,916 V107E probably damaging Het
Trim30a A T 7: 104,411,200 D456E possibly damaging Het
Ttll3 T C 6: 113,394,777 V45A possibly damaging Het
Ulk2 A G 11: 61,782,102 Y889H probably benign Het
Umodl1 A G 17: 30,959,151 S34G probably benign Het
Vmn1r67 A G 7: 10,446,976 I56V probably benign Het
Vmn2r120 C T 17: 57,508,874 G827E probably damaging Het
Zc3h6 T C 2: 129,015,635 probably null Het
Other mutations in Kif2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Kif2c APN 4 117178246 missense probably benign 0.01
IGL01020:Kif2c APN 4 117166904 missense probably damaging 1.00
IGL01131:Kif2c APN 4 117172365 missense probably damaging 1.00
IGL02131:Kif2c APN 4 117177953 missense possibly damaging 0.88
IGL02455:Kif2c APN 4 117172354 missense probably benign
IGL02556:Kif2c APN 4 117162605 missense probably damaging 0.98
IGL03084:Kif2c APN 4 117178158 missense possibly damaging 0.67
IGL03333:Kif2c APN 4 117180636 missense possibly damaging 0.87
IGL03353:Kif2c APN 4 117166336 missense probably benign 0.19
R0025:Kif2c UTSW 4 117165517 missense probably damaging 1.00
R0466:Kif2c UTSW 4 117172292 missense possibly damaging 0.83
R1069:Kif2c UTSW 4 117178153 missense probably damaging 0.97
R1519:Kif2c UTSW 4 117169940 missense probably damaging 1.00
R1594:Kif2c UTSW 4 117178188 missense probably benign 0.02
R1789:Kif2c UTSW 4 117167361 missense probably benign 0.18
R1894:Kif2c UTSW 4 117162223 missense probably benign 0.02
R2340:Kif2c UTSW 4 117169841 missense probably damaging 1.00
R2830:Kif2c UTSW 4 117182448 splice site probably null
R3734:Kif2c UTSW 4 117162646 missense probably benign 0.02
R4634:Kif2c UTSW 4 117178240 missense probably benign 0.04
R4720:Kif2c UTSW 4 117171749 missense probably benign
R4908:Kif2c UTSW 4 117166411 missense probably damaging 1.00
R5076:Kif2c UTSW 4 117174869 unclassified probably benign
R5855:Kif2c UTSW 4 117182542 unclassified probably benign
R6766:Kif2c UTSW 4 117167083 missense probably benign
R6767:Kif2c UTSW 4 117178188 missense probably benign 0.00
R6942:Kif2c UTSW 4 117166378 missense probably damaging 1.00
R7378:Kif2c UTSW 4 117162029 missense possibly damaging 0.46
R7526:Kif2c UTSW 4 117182432 missense possibly damaging 0.46
R8087:Kif2c UTSW 4 117165418 missense possibly damaging 0.92
U24488:Kif2c UTSW 4 117182442 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGAGTACCAAATTCAATCCCC -3'
(R):5'- GCCTCAGAACTTTGTGCCTG -3'

Sequencing Primer
(F):5'- GAGTACCAAATTCAATCCCCATTAAC -3'
(R):5'- TGGCTTCTCAGACTGGAGC -3'
Posted On2019-11-26