Incidental Mutation 'R7797:Gm5346'
ID600289
Institutional Source Beutler Lab
Gene Symbol Gm5346
Ensembl Gene ENSMUSG00000050190
Gene Namepredicted gene 5346
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R7797 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location43624951-43627276 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 43626374 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 271 (E271V)
Ref Sequence ENSEMBL: ENSMUSP00000058858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056023]
Predicted Effect probably benign
Transcript: ENSMUST00000056023
AA Change: E271V

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000058858
Gene: ENSMUSG00000050190
AA Change: E271V

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:Pep_M12B_propep 39 159 1.3e-18 PFAM
Pfam:Reprolysin_5 205 384 1.1e-15 PFAM
Pfam:Reprolysin_4 205 393 6.2e-9 PFAM
Pfam:Reprolysin 207 397 1.7e-46 PFAM
Pfam:Reprolysin_2 223 389 5.7e-14 PFAM
Pfam:Reprolysin_3 231 352 2.6e-13 PFAM
DISIN 416 491 2.48e-38 SMART
ACR 492 628 3.4e-65 SMART
EGF 634 664 2.69e1 SMART
transmembrane domain 685 707 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T C 17: 33,067,690 D46G probably damaging Het
9230110C19Rik G T 9: 8,027,129 P136Q possibly damaging Het
Abca8b A G 11: 109,971,683 probably null Het
Adam3 T G 8: 24,694,644 N535T probably damaging Het
Adamts4 A G 1: 171,257,818 K679E probably damaging Het
Arnt G A 3: 95,480,261 probably null Het
Asah2 A G 19: 32,022,361 F321L probably damaging Het
Asb15 T C 6: 24,562,506 S156P probably damaging Het
Baiap2l1 A C 5: 144,318,950 S65A probably damaging Het
Bend7 T G 2: 4,749,644 M186R probably damaging Het
Blnk T C 19: 40,959,788 K146E possibly damaging Het
Cd19 A G 7: 126,413,508 W238R probably damaging Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Cd44 T A 2: 102,848,734 N241I probably benign Het
Cdh23 T C 10: 60,385,194 E1257G probably benign Het
Cntnap5c T C 17: 58,359,275 V1100A probably benign Het
Cul7 T C 17: 46,658,642 V945A possibly damaging Het
Dock2 C T 11: 34,282,652 C1116Y probably damaging Het
Ehbp1 T C 11: 22,096,109 M547V possibly damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Grhl3 C G 4: 135,559,105 K88N possibly damaging Het
Hbb-y T A 7: 103,851,881 Y146F probably damaging Het
Hivep2 T C 10: 14,130,103 V815A probably benign Het
Hoxa7 T A 6: 52,215,890 I173F probably damaging Het
Igkv1-110 T G 6: 68,270,993 S29A probably benign Het
Jade2 A G 11: 51,817,299 S696P probably benign Het
Kif1b T A 4: 149,237,387 Q1025L probably benign Het
Kif2c A T 4: 117,171,743 C241S probably benign Het
Kmt2d G T 15: 98,864,406 H400N probably benign Het
Krt35 T A 11: 100,094,887 N174Y probably damaging Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Magi3 A G 3: 104,051,302 V489A probably damaging Het
Mapk7 T C 11: 61,489,415 E739G possibly damaging Het
Mcidas G A 13: 112,998,987 G315S probably damaging Het
Megf8 G A 7: 25,334,597 R607H probably damaging Het
Met T A 6: 17,533,953 N634K probably damaging Het
Miip C T 4: 147,862,918 G236S probably benign Het
Mmp11 G T 10: 75,923,480 T107K Het
Mroh2b A C 15: 4,949,105 N1378H probably benign Het
Naa15 G A 3: 51,448,610 C322Y probably damaging Het
Naip1 T A 13: 100,444,478 Y87F probably damaging Het
Ngrn A G 7: 80,264,437 D112G probably benign Het
Osbpl1a C A 18: 12,882,264 C369F probably damaging Het
Pcnx2 G C 8: 125,785,348 D1406E possibly damaging Het
Pold1 G A 7: 44,541,789 P206L probably benign Het
Psen1 A G 12: 83,699,622 S20G probably benign Het
Ptpn23 C T 9: 110,393,807 D61N possibly damaging Het
Rbfox3 A T 11: 118,496,484 L268Q possibly damaging Het
Rbm22 A G 18: 60,561,272 T26A probably damaging Het
Rpgrip1 G A 14: 52,133,820 R332Q possibly damaging Het
Rrm2b A T 15: 37,927,261 L347* probably null Het
Rsf1 A T 7: 97,661,485 D474V Het
Ryr2 C T 13: 11,801,180 R640Q probably damaging Het
Sec16b A G 1: 157,561,675 E691G unknown Het
Sept1 A T 7: 127,214,765 V365E unknown Het
Tlk2 A G 11: 105,210,618 H114R probably benign Het
Tmem200a A G 10: 25,993,966 I135T possibly damaging Het
Tpst2 T A 5: 112,307,916 V107E probably damaging Het
Trim30a A T 7: 104,411,200 D456E possibly damaging Het
Ttll3 T C 6: 113,394,777 V45A possibly damaging Het
Ulk2 A G 11: 61,782,102 Y889H probably benign Het
Umodl1 A G 17: 30,959,151 S34G probably benign Het
Vmn1r67 A G 7: 10,446,976 I56V probably benign Het
Vmn2r120 C T 17: 57,508,874 G827E probably damaging Het
Zc3h6 T C 2: 129,015,635 probably null Het
Other mutations in Gm5346
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Gm5346 APN 8 43625381 missense probably benign 0.12
IGL00391:Gm5346 APN 8 43625629 missense probably damaging 1.00
IGL00422:Gm5346 APN 8 43626351 missense probably damaging 1.00
IGL00664:Gm5346 APN 8 43625969 missense probably benign
IGL01095:Gm5346 APN 8 43626096 missense probably benign 0.22
IGL01113:Gm5346 APN 8 43626152 missense probably damaging 1.00
IGL01444:Gm5346 APN 8 43626433 missense probably benign 0.06
IGL01782:Gm5346 APN 8 43626735 missense probably benign 0.01
IGL01921:Gm5346 APN 8 43625511 missense probably damaging 0.96
IGL01964:Gm5346 APN 8 43626761 missense probably benign 0.00
IGL02139:Gm5346 APN 8 43625578 missense probably benign 0.01
IGL02555:Gm5346 APN 8 43625268 missense probably damaging 1.00
IGL02951:Gm5346 APN 8 43627088 missense possibly damaging 0.62
R0056:Gm5346 UTSW 8 43625503 nonsense probably null
R0218:Gm5346 UTSW 8 43626440 missense probably benign 0.00
R0530:Gm5346 UTSW 8 43626531 missense probably benign 0.00
R0925:Gm5346 UTSW 8 43626303 missense probably benign 0.11
R0927:Gm5346 UTSW 8 43625123 missense probably benign 0.00
R0975:Gm5346 UTSW 8 43625118 missense probably benign
R1300:Gm5346 UTSW 8 43626844 nonsense probably null
R1728:Gm5346 UTSW 8 43625583 missense probably damaging 1.00
R1729:Gm5346 UTSW 8 43625583 missense probably damaging 1.00
R1801:Gm5346 UTSW 8 43625917 nonsense probably null
R1869:Gm5346 UTSW 8 43625095 nonsense probably null
R1870:Gm5346 UTSW 8 43625095 nonsense probably null
R1871:Gm5346 UTSW 8 43625095 nonsense probably null
R1992:Gm5346 UTSW 8 43627139 missense probably benign 0.44
R2008:Gm5346 UTSW 8 43627037 missense probably benign 0.00
R2013:Gm5346 UTSW 8 43626405 missense possibly damaging 0.81
R2022:Gm5346 UTSW 8 43625917 nonsense probably null
R2175:Gm5346 UTSW 8 43625438 missense probably benign
R2875:Gm5346 UTSW 8 43627140 nonsense probably null
R3406:Gm5346 UTSW 8 43626052 nonsense probably null
R3845:Gm5346 UTSW 8 43626632 missense probably benign 0.00
R4033:Gm5346 UTSW 8 43626673 missense probably benign 0.28
R4072:Gm5346 UTSW 8 43626350 missense probably damaging 1.00
R4074:Gm5346 UTSW 8 43626350 missense probably damaging 1.00
R4075:Gm5346 UTSW 8 43626350 missense probably damaging 1.00
R4076:Gm5346 UTSW 8 43626350 missense probably damaging 1.00
R4153:Gm5346 UTSW 8 43626527 missense probably benign 0.04
R4330:Gm5346 UTSW 8 43626250 missense probably benign
R4612:Gm5346 UTSW 8 43626550 missense probably benign 0.09
R4662:Gm5346 UTSW 8 43627079 missense probably benign 0.26
R5032:Gm5346 UTSW 8 43626471 missense probably damaging 1.00
R5077:Gm5346 UTSW 8 43627163 missense possibly damaging 0.79
R5504:Gm5346 UTSW 8 43625282 missense probably damaging 1.00
R5697:Gm5346 UTSW 8 43626579 missense probably damaging 1.00
R6232:Gm5346 UTSW 8 43625912 missense probably benign 0.00
R6233:Gm5346 UTSW 8 43625912 missense probably benign 0.00
R6234:Gm5346 UTSW 8 43625912 missense probably benign 0.00
R6235:Gm5346 UTSW 8 43625912 missense probably benign 0.00
R6241:Gm5346 UTSW 8 43626096 missense probably benign 0.22
R6392:Gm5346 UTSW 8 43626001 missense probably benign 0.09
R6439:Gm5346 UTSW 8 43625951 missense probably damaging 1.00
R6454:Gm5346 UTSW 8 43626808 missense probably damaging 0.96
R6455:Gm5346 UTSW 8 43626152 missense probably damaging 1.00
R6767:Gm5346 UTSW 8 43626914 missense probably damaging 1.00
R6774:Gm5346 UTSW 8 43625183 missense probably benign 0.00
R6877:Gm5346 UTSW 8 43625237 missense probably benign 0.02
R6911:Gm5346 UTSW 8 43625109 missense probably benign 0.02
R7211:Gm5346 UTSW 8 43625877 missense probably damaging 1.00
R7597:Gm5346 UTSW 8 43625244 missense probably damaging 1.00
R7602:Gm5346 UTSW 8 43626666 missense probably damaging 0.99
RF001:Gm5346 UTSW 8 43626905 missense possibly damaging 0.79
Z1177:Gm5346 UTSW 8 43626546 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGCTACGATGAATGCCAGATATG -3'
(R):5'- ATTGGTGGACCCATCACAGG -3'

Sequencing Primer
(F):5'- TACGATGAATGCCAGATATGATAACG -3'
(R):5'- TGGACCCATCACAGGTTTATTG -3'
Posted On2019-11-26