Incidental Mutation 'R7797:Pcnx2'
ID600290
Institutional Source Beutler Lab
Gene Symbol Pcnx2
Ensembl Gene ENSMUSG00000060212
Gene Namepecanex homolog 2
SynonymsPcnxl2, E330039K12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7797 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location125751508-125898317 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 125785348 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1406 (D1406E)
Ref Sequence ENSEMBL: ENSMUSP00000042294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047239]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047239
AA Change: D1406E

PolyPhen 2 Score 0.698 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000042294
Gene: ENSMUSG00000060212
AA Change: D1406E

DomainStartEndE-ValueType
transmembrane domain 36 53 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
low complexity region 94 104 N/A INTRINSIC
low complexity region 391 415 N/A INTRINSIC
low complexity region 457 476 N/A INTRINSIC
low complexity region 727 742 N/A INTRINSIC
low complexity region 806 817 N/A INTRINSIC
transmembrane domain 823 842 N/A INTRINSIC
transmembrane domain 849 866 N/A INTRINSIC
transmembrane domain 881 902 N/A INTRINSIC
transmembrane domain 934 956 N/A INTRINSIC
transmembrane domain 976 998 N/A INTRINSIC
transmembrane domain 1011 1030 N/A INTRINSIC
transmembrane domain 1080 1102 N/A INTRINSIC
transmembrane domain 1104 1126 N/A INTRINSIC
Pfam:Pecanex_C 1603 1828 3.5e-113 PFAM
low complexity region 1864 1889 N/A INTRINSIC
low complexity region 1968 1981 N/A INTRINSIC
low complexity region 2004 2019 N/A INTRINSIC
Meta Mutation Damage Score 0.1317 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene contains coding mononucleotide repeats that are associated with tumors of high mcrosatellite instability (MSI-H). Defects in this gene are involved in the tumorigenesis of MSI-H colorectal carcinomas. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T C 17: 33,067,690 D46G probably damaging Het
9230110C19Rik G T 9: 8,027,129 P136Q possibly damaging Het
Abca8b A G 11: 109,971,683 probably null Het
Adam3 T G 8: 24,694,644 N535T probably damaging Het
Adamts4 A G 1: 171,257,818 K679E probably damaging Het
Arnt G A 3: 95,480,261 probably null Het
Asah2 A G 19: 32,022,361 F321L probably damaging Het
Asb15 T C 6: 24,562,506 S156P probably damaging Het
Baiap2l1 A C 5: 144,318,950 S65A probably damaging Het
Bend7 T G 2: 4,749,644 M186R probably damaging Het
Blnk T C 19: 40,959,788 K146E possibly damaging Het
Cd19 A G 7: 126,413,508 W238R probably damaging Het
Cd44 T A 2: 102,848,734 N241I probably benign Het
Cdh23 T C 10: 60,385,194 E1257G probably benign Het
Cntnap5c T C 17: 58,359,275 V1100A probably benign Het
Cul7 T C 17: 46,658,642 V945A possibly damaging Het
Dock2 C T 11: 34,282,652 C1116Y probably damaging Het
Ehbp1 T C 11: 22,096,109 M547V possibly damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Gm5346 T A 8: 43,626,374 E271V probably benign Het
Grhl3 C G 4: 135,559,105 K88N possibly damaging Het
Hbb-y T A 7: 103,851,881 Y146F probably damaging Het
Hivep2 T C 10: 14,130,103 V815A probably benign Het
Hoxa7 T A 6: 52,215,890 I173F probably damaging Het
Igkv1-110 T G 6: 68,270,993 S29A probably benign Het
Jade2 A G 11: 51,817,299 S696P probably benign Het
Kif1b T A 4: 149,237,387 Q1025L probably benign Het
Kif2c A T 4: 117,171,743 C241S probably benign Het
Kmt2d G T 15: 98,864,406 H400N probably benign Het
Krt35 T A 11: 100,094,887 N174Y probably damaging Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Magi3 A G 3: 104,051,302 V489A probably damaging Het
Mapk7 T C 11: 61,489,415 E739G possibly damaging Het
Mcidas G A 13: 112,998,987 G315S probably damaging Het
Mdga1 C T 17: 29,842,840 probably null Het
Megf8 G A 7: 25,334,597 R607H probably damaging Het
Met T A 6: 17,533,953 N634K probably damaging Het
Miip C T 4: 147,862,918 G236S probably benign Het
Mmp11 G T 10: 75,923,480 T107K Het
Mroh2b A C 15: 4,949,105 N1378H probably benign Het
Naa15 G A 3: 51,448,610 C322Y probably damaging Het
Naip1 T A 13: 100,444,478 Y87F probably damaging Het
Ngrn A G 7: 80,264,437 D112G probably benign Het
Osbpl1a C A 18: 12,882,264 C369F probably damaging Het
Pold1 G A 7: 44,541,789 P206L probably benign Het
Psen1 A G 12: 83,699,622 S20G probably benign Het
Ptpn23 C T 9: 110,393,807 D61N possibly damaging Het
Rbfox3 A T 11: 118,496,484 L268Q possibly damaging Het
Rbm22 A G 18: 60,561,272 T26A probably damaging Het
Rpgrip1 G A 14: 52,133,820 R332Q possibly damaging Het
Rrm2b A T 15: 37,927,261 L347* probably null Het
Rsf1 A T 7: 97,661,485 D474V Het
Ryr2 C T 13: 11,801,180 R640Q probably damaging Het
Sec16b A G 1: 157,561,675 E691G unknown Het
Sept1 A T 7: 127,214,765 V365E unknown Het
Tlk2 A G 11: 105,210,618 H114R probably benign Het
Tmem200a A G 10: 25,993,966 I135T possibly damaging Het
Tpst2 T A 5: 112,307,916 V107E probably damaging Het
Trim30a A T 7: 104,411,200 D456E possibly damaging Het
Ttll3 T C 6: 113,394,777 V45A possibly damaging Het
Ulk2 A G 11: 61,782,102 Y889H probably benign Het
Umodl1 A G 17: 30,959,151 S34G probably benign Het
Vmn1r67 A G 7: 10,446,976 I56V probably benign Het
Vmn2r120 C T 17: 57,508,874 G827E probably damaging Het
Zc3h6 T C 2: 129,015,635 probably null Het
Other mutations in Pcnx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Pcnx2 APN 8 125887585 missense probably damaging 1.00
IGL00900:Pcnx2 APN 8 125863236 splice site probably benign
IGL01134:Pcnx2 APN 8 125863150 missense probably benign
IGL01370:Pcnx2 APN 8 125801483 missense probably damaging 0.96
IGL01452:Pcnx2 APN 8 125838032 missense probably damaging 1.00
IGL01477:Pcnx2 APN 8 125785305 missense probably damaging 1.00
IGL01610:Pcnx2 APN 8 125839633 missense possibly damaging 0.67
IGL01640:Pcnx2 APN 8 125801558 missense probably benign 0.14
IGL01645:Pcnx2 APN 8 125887917 missense probably damaging 1.00
IGL01876:Pcnx2 APN 8 125866031 missense probably benign 0.31
IGL01933:Pcnx2 APN 8 125761654 missense probably damaging 1.00
IGL02208:Pcnx2 APN 8 125752155 missense probably benign 0.30
IGL02573:Pcnx2 APN 8 125855273 missense probably benign 0.34
IGL02810:Pcnx2 APN 8 125887203 missense probably benign 0.03
IGL02859:Pcnx2 APN 8 125863173 missense probably damaging 1.00
IGL02879:Pcnx2 APN 8 125772057 missense probably damaging 1.00
IGL03202:Pcnx2 APN 8 125772044 missense probably damaging 0.98
IGL03259:Pcnx2 APN 8 125753649 missense probably benign 0.19
IGL03395:Pcnx2 APN 8 125887523 missense probably benign 0.00
IGL03410:Pcnx2 APN 8 125887040 missense probably damaging 1.00
gallen UTSW 8 125891120 missense probably damaging 1.00
hotzone UTSW 8 125891141 missense probably benign 0.00
R0107:Pcnx2 UTSW 8 125753586 missense probably benign 0.29
R0477:Pcnx2 UTSW 8 125761567 missense probably damaging 0.99
R0610:Pcnx2 UTSW 8 125839687 missense probably damaging 1.00
R0645:Pcnx2 UTSW 8 125760720 missense possibly damaging 0.64
R0894:Pcnx2 UTSW 8 125886926 splice site probably benign
R1083:Pcnx2 UTSW 8 125772104 missense probably damaging 1.00
R1199:Pcnx2 UTSW 8 125887314 missense possibly damaging 0.60
R1296:Pcnx2 UTSW 8 125773833 missense probably damaging 1.00
R1445:Pcnx2 UTSW 8 125752284 missense probably damaging 0.99
R1467:Pcnx2 UTSW 8 125753550 missense possibly damaging 0.77
R1467:Pcnx2 UTSW 8 125753550 missense possibly damaging 0.77
R1524:Pcnx2 UTSW 8 125891141 missense probably benign 0.00
R1537:Pcnx2 UTSW 8 125877449 missense possibly damaging 0.94
R1574:Pcnx2 UTSW 8 125773930 missense probably damaging 1.00
R1574:Pcnx2 UTSW 8 125773930 missense probably damaging 1.00
R1593:Pcnx2 UTSW 8 125759273 missense probably benign 0.11
R1598:Pcnx2 UTSW 8 125772086 missense probably benign 0.03
R1603:Pcnx2 UTSW 8 125839626 missense probably damaging 1.00
R1697:Pcnx2 UTSW 8 125850348 missense probably damaging 1.00
R1759:Pcnx2 UTSW 8 125773978 missense probably damaging 1.00
R1855:Pcnx2 UTSW 8 125807996 splice site probably benign
R1863:Pcnx2 UTSW 8 125818786 missense probably damaging 0.98
R1930:Pcnx2 UTSW 8 125887714 missense probably benign 0.10
R1967:Pcnx2 UTSW 8 125815683 missense possibly damaging 0.51
R1974:Pcnx2 UTSW 8 125887371 missense probably benign 0.00
R1998:Pcnx2 UTSW 8 125887143 missense probably damaging 1.00
R2034:Pcnx2 UTSW 8 125818667 critical splice donor site probably null
R2072:Pcnx2 UTSW 8 125761742 missense possibly damaging 0.90
R2096:Pcnx2 UTSW 8 125759248 missense probably benign 0.27
R2216:Pcnx2 UTSW 8 125888077 missense probably benign 0.00
R2290:Pcnx2 UTSW 8 125877595 splice site probably benign
R2373:Pcnx2 UTSW 8 125753451 missense probably damaging 1.00
R2484:Pcnx2 UTSW 8 125891120 missense probably damaging 1.00
R2849:Pcnx2 UTSW 8 125760927 missense probably damaging 1.00
R2891:Pcnx2 UTSW 8 125891058 missense probably damaging 1.00
R2892:Pcnx2 UTSW 8 125891058 missense probably damaging 1.00
R2970:Pcnx2 UTSW 8 125801536 missense probably damaging 1.00
R3013:Pcnx2 UTSW 8 125887770 missense probably benign 0.05
R3608:Pcnx2 UTSW 8 125888101 missense probably benign
R3876:Pcnx2 UTSW 8 125888158 missense probably benign
R4349:Pcnx2 UTSW 8 125762851 missense probably damaging 0.98
R4352:Pcnx2 UTSW 8 125762851 missense probably damaging 0.98
R4353:Pcnx2 UTSW 8 125762851 missense probably damaging 0.98
R4361:Pcnx2 UTSW 8 125768298 nonsense probably null
R4735:Pcnx2 UTSW 8 125828041 critical splice donor site probably null
R4749:Pcnx2 UTSW 8 125887588 missense probably damaging 1.00
R4812:Pcnx2 UTSW 8 125865939 missense probably benign 0.00
R4819:Pcnx2 UTSW 8 125855230 missense probably benign 0.04
R4829:Pcnx2 UTSW 8 125861058 splice site probably null
R4832:Pcnx2 UTSW 8 125752188 missense probably damaging 0.99
R4876:Pcnx2 UTSW 8 125772108 missense probably damaging 1.00
R4974:Pcnx2 UTSW 8 125851130 missense probably benign 0.00
R5057:Pcnx2 UTSW 8 125855191 missense possibly damaging 0.95
R5078:Pcnx2 UTSW 8 125752156 missense probably benign
R5114:Pcnx2 UTSW 8 125838010 missense possibly damaging 0.89
R5195:Pcnx2 UTSW 8 125801549 missense possibly damaging 0.69
R5239:Pcnx2 UTSW 8 125861082 splice site probably null
R5348:Pcnx2 UTSW 8 125818756 missense probably damaging 1.00
R5398:Pcnx2 UTSW 8 125887948 missense possibly damaging 0.63
R5448:Pcnx2 UTSW 8 125888149 missense probably benign 0.14
R5534:Pcnx2 UTSW 8 125838015 missense possibly damaging 0.65
R5624:Pcnx2 UTSW 8 125761523 critical splice donor site probably null
R5629:Pcnx2 UTSW 8 125898041 missense probably damaging 1.00
R5630:Pcnx2 UTSW 8 125860958 missense probably damaging 0.99
R5782:Pcnx2 UTSW 8 125753484 missense probably damaging 1.00
R5877:Pcnx2 UTSW 8 125753728 missense probably damaging 0.99
R5879:Pcnx2 UTSW 8 125773946 missense probably damaging 1.00
R6114:Pcnx2 UTSW 8 125773947 missense probably damaging 1.00
R6152:Pcnx2 UTSW 8 125753752 missense probably damaging 0.99
R6154:Pcnx2 UTSW 8 125762813 missense probably damaging 1.00
R6283:Pcnx2 UTSW 8 125877586 missense probably damaging 0.99
R6500:Pcnx2 UTSW 8 125753485 missense probably damaging 1.00
R6629:Pcnx2 UTSW 8 125891112 missense probably benign 0.00
R6708:Pcnx2 UTSW 8 125860953 critical splice donor site probably null
R6736:Pcnx2 UTSW 8 125752317 splice site probably null
R6748:Pcnx2 UTSW 8 125850335 missense probably damaging 1.00
R6788:Pcnx2 UTSW 8 125772100 missense probably damaging 1.00
R6849:Pcnx2 UTSW 8 125861210 missense probably damaging 1.00
R6947:Pcnx2 UTSW 8 125850282 critical splice donor site probably null
R7034:Pcnx2 UTSW 8 125785302 missense probably damaging 1.00
R7100:Pcnx2 UTSW 8 125759114 missense probably benign 0.16
R7124:Pcnx2 UTSW 8 125753617 missense probably damaging 0.99
R7130:Pcnx2 UTSW 8 125753584 nonsense probably null
R7133:Pcnx2 UTSW 8 125801504 missense probably benign 0.01
R7271:Pcnx2 UTSW 8 125886951 missense probably benign
R7326:Pcnx2 UTSW 8 125887083 missense probably damaging 1.00
R7373:Pcnx2 UTSW 8 125808027 missense probably damaging 1.00
R7397:Pcnx2 UTSW 8 125890885 splice site probably null
R7662:Pcnx2 UTSW 8 125818771 nonsense probably null
R7693:Pcnx2 UTSW 8 125887125 missense probably benign 0.09
R7726:Pcnx2 UTSW 8 125850330 missense probably benign 0.00
R7745:Pcnx2 UTSW 8 125851107 missense probably benign 0.04
R7792:Pcnx2 UTSW 8 125892018 missense possibly damaging 0.63
R7921:Pcnx2 UTSW 8 125837863 missense probably benign
R7984:Pcnx2 UTSW 8 125759126 missense probably benign
R8098:Pcnx2 UTSW 8 125768301 missense probably damaging 1.00
R8277:Pcnx2 UTSW 8 125866016 missense probably damaging 1.00
R8312:Pcnx2 UTSW 8 125762850 missense possibly damaging 0.69
R8354:Pcnx2 UTSW 8 125761618 missense probably damaging 0.99
R8378:Pcnx2 UTSW 8 125760910 missense probably damaging 1.00
R8713:Pcnx2 UTSW 8 125818786 missense probably damaging 1.00
R8714:Pcnx2 UTSW 8 125773807 missense probably benign
R8753:Pcnx2 UTSW 8 125887260 missense probably benign 0.15
R8790:Pcnx2 UTSW 8 125877567 missense probably benign
R8925:Pcnx2 UTSW 8 125887920 missense probably benign 0.01
R8927:Pcnx2 UTSW 8 125887920 missense probably benign 0.01
RF018:Pcnx2 UTSW 8 125877519 missense probably damaging 1.00
Z1088:Pcnx2 UTSW 8 125826928 missense probably damaging 1.00
Z1088:Pcnx2 UTSW 8 125866018 missense probably damaging 1.00
Z1176:Pcnx2 UTSW 8 125761654 missense probably damaging 1.00
Z1176:Pcnx2 UTSW 8 125838014 missense probably benign 0.30
Z1177:Pcnx2 UTSW 8 125887960 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGAGGTTTCTAAGCAGTGC -3'
(R):5'- TGTGTACATAAAGACCAGCCTCAC -3'

Sequencing Primer
(F):5'- AGTGCTCTCTGCCTGATGACAC -3'
(R):5'- ACACCGTTTCAGGGTCTGAG -3'
Posted On2019-11-26