Incidental Mutation 'R7797:Mapk7'
ID600300
Institutional Source Beutler Lab
Gene Symbol Mapk7
Ensembl Gene ENSMUSG00000001034
Gene Namemitogen-activated protein kinase 7
Synonymsbig MAP kinase 1, Erk5-T, BMK1, ERK5
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7797 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location61488812-61494406 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 61489415 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 739 (E739G)
Ref Sequence ENSEMBL: ENSMUSP00000078087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040522] [ENSMUST00000064783] [ENSMUST00000079080] [ENSMUST00000101085] [ENSMUST00000108714] [ENSMUST00000153441]
Predicted Effect probably benign
Transcript: ENSMUST00000040522
SMART Domains Protein: ENSMUSP00000038971
Gene: ENSMUSG00000042436

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
FBG 38 280 5.6e-119 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000064783
SMART Domains Protein: ENSMUSP00000070848
Gene: ENSMUSG00000042436

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
FBG 38 257 3.39e-130 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000079080
AA Change: E739G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000078087
Gene: ENSMUSG00000001034
AA Change: E739G

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
S_TKc 55 347 5.66e-96 SMART
low complexity region 433 447 N/A INTRINSIC
low complexity region 476 492 N/A INTRINSIC
coiled coil region 508 544 N/A INTRINSIC
low complexity region 578 603 N/A INTRINSIC
low complexity region 620 644 N/A INTRINSIC
low complexity region 675 692 N/A INTRINSIC
low complexity region 758 772 N/A INTRINSIC
low complexity region 791 803 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000101085
AA Change: E636G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000098646
Gene: ENSMUSG00000001034
AA Change: E636G

DomainStartEndE-ValueType
S_TKc 4 277 3.48e-73 SMART
low complexity region 363 377 N/A INTRINSIC
coiled coil region 405 441 N/A INTRINSIC
low complexity region 475 500 N/A INTRINSIC
low complexity region 517 541 N/A INTRINSIC
low complexity region 572 589 N/A INTRINSIC
low complexity region 655 669 N/A INTRINSIC
low complexity region 688 700 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108714
AA Change: E670G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104354
Gene: ENSMUSG00000001034
AA Change: E670G

DomainStartEndE-ValueType
S_TKc 1 278 1.76e-74 SMART
low complexity region 364 378 N/A INTRINSIC
low complexity region 407 423 N/A INTRINSIC
coiled coil region 439 475 N/A INTRINSIC
low complexity region 509 534 N/A INTRINSIC
low complexity region 551 575 N/A INTRINSIC
low complexity region 606 623 N/A INTRINSIC
low complexity region 689 703 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153441
SMART Domains Protein: ENSMUSP00000116084
Gene: ENSMUSG00000001034

DomainStartEndE-ValueType
PDB:4IC8|B 1 49 2e-26 PDB
low complexity region 51 65 N/A INTRINSIC
low complexity region 94 110 N/A INTRINSIC
coiled coil region 126 162 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. This kinase is specifically activated by mitogen-activated protein kinase kinase 5 (MAP2K5/MEK5). It is involved in the downstream signaling processes of various receptor molecules including receptor type kinases, and G protein-coupled receptors. In response to extracelluar signals, this kinase translocates to cell nucleus, where it regulates gene expression by phosphorylating, and activating different transcription factors. Four alternatively spliced transcript variants of this gene encoding two distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to embryonic growth retardation and midgestational lethality due to multiple developmental anomalies and vascular remodelling, cardiac development, and placental defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T C 17: 33,067,690 D46G probably damaging Het
9230110C19Rik G T 9: 8,027,129 P136Q possibly damaging Het
Abca8b A G 11: 109,971,683 probably null Het
Adam3 T G 8: 24,694,644 N535T probably damaging Het
Adamts4 A G 1: 171,257,818 K679E probably damaging Het
Arnt G A 3: 95,480,261 probably null Het
Asah2 A G 19: 32,022,361 F321L probably damaging Het
Asb15 T C 6: 24,562,506 S156P probably damaging Het
Baiap2l1 A C 5: 144,318,950 S65A probably damaging Het
Bend7 T G 2: 4,749,644 M186R probably damaging Het
Blnk T C 19: 40,959,788 K146E possibly damaging Het
Cd19 A G 7: 126,413,508 W238R probably damaging Het
Cd44 T A 2: 102,848,734 N241I probably benign Het
Cdh23 T C 10: 60,385,194 E1257G probably benign Het
Cntnap5c T C 17: 58,359,275 V1100A probably benign Het
Cul7 T C 17: 46,658,642 V945A possibly damaging Het
Dock2 C T 11: 34,282,652 C1116Y probably damaging Het
Ehbp1 T C 11: 22,096,109 M547V possibly damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Gm5346 T A 8: 43,626,374 E271V probably benign Het
Grhl3 C G 4: 135,559,105 K88N possibly damaging Het
Hbb-y T A 7: 103,851,881 Y146F probably damaging Het
Hivep2 T C 10: 14,130,103 V815A probably benign Het
Hoxa7 T A 6: 52,215,890 I173F probably damaging Het
Igkv1-110 T G 6: 68,270,993 S29A probably benign Het
Jade2 A G 11: 51,817,299 S696P probably benign Het
Kif1b T A 4: 149,237,387 Q1025L probably benign Het
Kif2c A T 4: 117,171,743 C241S probably benign Het
Kmt2d G T 15: 98,864,406 H400N probably benign Het
Krt35 T A 11: 100,094,887 N174Y probably damaging Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Magi3 A G 3: 104,051,302 V489A probably damaging Het
Mcidas G A 13: 112,998,987 G315S probably damaging Het
Mdga1 C T 17: 29,842,840 probably null Het
Megf8 G A 7: 25,334,597 R607H probably damaging Het
Met T A 6: 17,533,953 N634K probably damaging Het
Miip C T 4: 147,862,918 G236S probably benign Het
Mmp11 G T 10: 75,923,480 T107K Het
Mroh2b A C 15: 4,949,105 N1378H probably benign Het
Naa15 G A 3: 51,448,610 C322Y probably damaging Het
Naip1 T A 13: 100,444,478 Y87F probably damaging Het
Ngrn A G 7: 80,264,437 D112G probably benign Het
Osbpl1a C A 18: 12,882,264 C369F probably damaging Het
Pcnx2 G C 8: 125,785,348 D1406E possibly damaging Het
Pold1 G A 7: 44,541,789 P206L probably benign Het
Psen1 A G 12: 83,699,622 S20G probably benign Het
Ptpn23 C T 9: 110,393,807 D61N possibly damaging Het
Rbfox3 A T 11: 118,496,484 L268Q possibly damaging Het
Rbm22 A G 18: 60,561,272 T26A probably damaging Het
Rpgrip1 G A 14: 52,133,820 R332Q possibly damaging Het
Rrm2b A T 15: 37,927,261 L347* probably null Het
Rsf1 A T 7: 97,661,485 D474V Het
Ryr2 C T 13: 11,801,180 R640Q probably damaging Het
Sec16b A G 1: 157,561,675 E691G unknown Het
Sept1 A T 7: 127,214,765 V365E unknown Het
Tlk2 A G 11: 105,210,618 H114R probably benign Het
Tmem200a A G 10: 25,993,966 I135T possibly damaging Het
Tpst2 T A 5: 112,307,916 V107E probably damaging Het
Trim30a A T 7: 104,411,200 D456E possibly damaging Het
Ttll3 T C 6: 113,394,777 V45A possibly damaging Het
Ulk2 A G 11: 61,782,102 Y889H probably benign Het
Umodl1 A G 17: 30,959,151 S34G probably benign Het
Vmn1r67 A G 7: 10,446,976 I56V probably benign Het
Vmn2r120 C T 17: 57,508,874 G827E probably damaging Het
Zc3h6 T C 2: 129,015,635 probably null Het
Other mutations in Mapk7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01510:Mapk7 APN 11 61491160 missense probably damaging 1.00
IGL02289:Mapk7 APN 11 61489959 splice site probably null
IGL03108:Mapk7 APN 11 61491672 missense probably damaging 1.00
IGL03342:Mapk7 APN 11 61491390 missense probably damaging 1.00
FR4340:Mapk7 UTSW 11 61490206 intron probably benign
FR4589:Mapk7 UTSW 11 61490222 intron probably benign
R1497:Mapk7 UTSW 11 61493863 missense possibly damaging 0.53
R1866:Mapk7 UTSW 11 61489413 missense probably benign 0.27
R2870:Mapk7 UTSW 11 61490212 intron probably benign
R2871:Mapk7 UTSW 11 61490212 intron probably benign
R2872:Mapk7 UTSW 11 61490212 intron probably benign
R3831:Mapk7 UTSW 11 61489854 missense possibly damaging 0.83
R3832:Mapk7 UTSW 11 61489854 missense possibly damaging 0.83
R3833:Mapk7 UTSW 11 61489854 missense possibly damaging 0.83
R4378:Mapk7 UTSW 11 61493667 missense probably damaging 1.00
R4428:Mapk7 UTSW 11 61489229 missense possibly damaging 0.90
R4642:Mapk7 UTSW 11 61490901 missense probably damaging 0.99
R4692:Mapk7 UTSW 11 61489242 missense possibly damaging 0.73
R4718:Mapk7 UTSW 11 61489254 missense possibly damaging 0.73
R4755:Mapk7 UTSW 11 61490843 missense probably damaging 1.00
R4916:Mapk7 UTSW 11 61493649 missense probably damaging 0.97
R4933:Mapk7 UTSW 11 61493908 unclassified probably benign
R5825:Mapk7 UTSW 11 61490381 missense possibly damaging 0.66
R5875:Mapk7 UTSW 11 61493698 missense probably benign 0.13
R5910:Mapk7 UTSW 11 61493621 start codon destroyed probably benign 0.01
R7201:Mapk7 UTSW 11 61489172 missense probably benign 0.33
R7465:Mapk7 UTSW 11 61490453 missense probably damaging 1.00
R8867:Mapk7 UTSW 11 61493806 missense probably benign 0.41
R8953:Mapk7 UTSW 11 61492966 missense possibly damaging 0.81
RF031:Mapk7 UTSW 11 61490234 intron probably benign
Z1177:Mapk7 UTSW 11 61491362 missense probably damaging 1.00
Z1186:Mapk7 UTSW 11 61490212 intron probably benign
Z1186:Mapk7 UTSW 11 61490216 intron probably benign
Z1186:Mapk7 UTSW 11 61490227 intron probably benign
Z1187:Mapk7 UTSW 11 61490212 intron probably benign
Z1187:Mapk7 UTSW 11 61490227 intron probably benign
Z1188:Mapk7 UTSW 11 61490212 intron probably benign
Z1188:Mapk7 UTSW 11 61490227 intron probably benign
Z1188:Mapk7 UTSW 11 61490244 intron probably benign
Z1189:Mapk7 UTSW 11 61490227 intron probably benign
Z1190:Mapk7 UTSW 11 61490227 intron probably benign
Z1191:Mapk7 UTSW 11 61490212 intron probably benign
Z1191:Mapk7 UTSW 11 61490227 intron probably benign
Z1192:Mapk7 UTSW 11 61490227 intron probably benign
Predicted Primers PCR Primer
(F):5'- TCAAGCCAGTCAGCAAGGAG -3'
(R):5'- CAAGGCAGTGTTCATGCTCTG -3'

Sequencing Primer
(F):5'- CCAGTCAGCAAGGAGAGAGGC -3'
(R):5'- CAGTGTTCATGCTCTGGGATATC -3'
Posted On2019-11-26