Incidental Mutation 'R7797:Rrm2b'
ID600314
Institutional Source Beutler Lab
Gene Symbol Rrm2b
Ensembl Gene ENSMUSG00000022292
Gene Nameribonucleotide reductase M2 B (TP53 inducible)
Synonymsp53R2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.519) question?
Stock #R7797 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location37923952-37961318 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 37927261 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 347 (L347*)
Ref Sequence ENSEMBL: ENSMUSP00000022901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022901] [ENSMUST00000137636] [ENSMUST00000144498] [ENSMUST00000146821] [ENSMUST00000153481]
Predicted Effect probably null
Transcript: ENSMUST00000022901
AA Change: L347*
SMART Domains Protein: ENSMUSP00000022901
Gene: ENSMUSG00000022292
AA Change: L347*

DomainStartEndE-ValueType
Pfam:Ribonuc_red_sm 41 308 4.2e-120 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000137636
AA Change: L295*
SMART Domains Protein: ENSMUSP00000119400
Gene: ENSMUSG00000022292
AA Change: L295*

DomainStartEndE-ValueType
Pfam:Ribonuc_red_sm 6 261 1.7e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144498
SMART Domains Protein: ENSMUSP00000121069
Gene: ENSMUSG00000022292

DomainStartEndE-ValueType
Pfam:Ribonuc_red_sm 32 111 2.2e-29 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000146821
AA Change: L135*
SMART Domains Protein: ENSMUSP00000123691
Gene: ENSMUSG00000022292
AA Change: L135*

DomainStartEndE-ValueType
Pfam:Ribonuc_red_sm 13 101 1e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153481
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the small subunit of a p53-inducible ribonucleotide reductase. This heterotetrameric enzyme catalyzes the conversion of ribonucleoside diphosphates to deoxyribonucleoside diphosphates. The product of this reaction is necessary for DNA synthesis. Mutations in this gene have been associated with autosomal recessive mitochondrial DNA depletion syndrome, autosomal dominant progressive external ophthalmoplegia-5, and mitochondrial neurogastrointestinal encephalopathy. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]
PHENOTYPE: Loss of both functional copies of this gene results in growth retardation, multiple organ failure, and ultimately premature death due to kidney failure. Spontaneous mutation rates and apoptosis are increased in the kidneys due to an attenuation of dNTP pools and a resulting impairment of DNA repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T C 17: 33,067,690 D46G probably damaging Het
9230110C19Rik G T 9: 8,027,129 P136Q possibly damaging Het
Abca8b A G 11: 109,971,683 probably null Het
Adam3 T G 8: 24,694,644 N535T probably damaging Het
Adamts4 A G 1: 171,257,818 K679E probably damaging Het
Arnt G A 3: 95,480,261 probably null Het
Asah2 A G 19: 32,022,361 F321L probably damaging Het
Asb15 T C 6: 24,562,506 S156P probably damaging Het
Baiap2l1 A C 5: 144,318,950 S65A probably damaging Het
Bend7 T G 2: 4,749,644 M186R probably damaging Het
Blnk T C 19: 40,959,788 K146E possibly damaging Het
Cd19 A G 7: 126,413,508 W238R probably damaging Het
Cd44 T A 2: 102,848,734 N241I probably benign Het
Cdh23 T C 10: 60,385,194 E1257G probably benign Het
Cntnap5c T C 17: 58,359,275 V1100A probably benign Het
Cul7 T C 17: 46,658,642 V945A possibly damaging Het
Dock2 C T 11: 34,282,652 C1116Y probably damaging Het
Ehbp1 T C 11: 22,096,109 M547V possibly damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Gm5346 T A 8: 43,626,374 E271V probably benign Het
Grhl3 C G 4: 135,559,105 K88N possibly damaging Het
Hbb-y T A 7: 103,851,881 Y146F probably damaging Het
Hivep2 T C 10: 14,130,103 V815A probably benign Het
Hoxa7 T A 6: 52,215,890 I173F probably damaging Het
Igkv1-110 T G 6: 68,270,993 S29A probably benign Het
Jade2 A G 11: 51,817,299 S696P probably benign Het
Kif1b T A 4: 149,237,387 Q1025L probably benign Het
Kif2c A T 4: 117,171,743 C241S probably benign Het
Kmt2d G T 15: 98,864,406 H400N probably benign Het
Krt35 T A 11: 100,094,887 N174Y probably damaging Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Magi3 A G 3: 104,051,302 V489A probably damaging Het
Mapk7 T C 11: 61,489,415 E739G possibly damaging Het
Mcidas G A 13: 112,998,987 G315S probably damaging Het
Mdga1 C T 17: 29,842,840 probably null Het
Megf8 G A 7: 25,334,597 R607H probably damaging Het
Met T A 6: 17,533,953 N634K probably damaging Het
Miip C T 4: 147,862,918 G236S probably benign Het
Mmp11 G T 10: 75,923,480 T107K Het
Mroh2b A C 15: 4,949,105 N1378H probably benign Het
Naa15 G A 3: 51,448,610 C322Y probably damaging Het
Naip1 T A 13: 100,444,478 Y87F probably damaging Het
Ngrn A G 7: 80,264,437 D112G probably benign Het
Osbpl1a C A 18: 12,882,264 C369F probably damaging Het
Pcnx2 G C 8: 125,785,348 D1406E possibly damaging Het
Pold1 G A 7: 44,541,789 P206L probably benign Het
Psen1 A G 12: 83,699,622 S20G probably benign Het
Ptpn23 C T 9: 110,393,807 D61N possibly damaging Het
Rbfox3 A T 11: 118,496,484 L268Q possibly damaging Het
Rbm22 A G 18: 60,561,272 T26A probably damaging Het
Rpgrip1 G A 14: 52,133,820 R332Q possibly damaging Het
Rsf1 A T 7: 97,661,485 D474V Het
Ryr2 C T 13: 11,801,180 R640Q probably damaging Het
Sec16b A G 1: 157,561,675 E691G unknown Het
Sept1 A T 7: 127,214,765 V365E unknown Het
Tlk2 A G 11: 105,210,618 H114R probably benign Het
Tmem200a A G 10: 25,993,966 I135T possibly damaging Het
Tpst2 T A 5: 112,307,916 V107E probably damaging Het
Trim30a A T 7: 104,411,200 D456E possibly damaging Het
Ttll3 T C 6: 113,394,777 V45A possibly damaging Het
Ulk2 A G 11: 61,782,102 Y889H probably benign Het
Umodl1 A G 17: 30,959,151 S34G probably benign Het
Vmn1r67 A G 7: 10,446,976 I56V probably benign Het
Vmn2r120 C T 17: 57,508,874 G827E probably damaging Het
Zc3h6 T C 2: 129,015,635 probably null Het
Other mutations in Rrm2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00581:Rrm2b APN 15 37929075 missense probably damaging 1.00
IGL00806:Rrm2b APN 15 37931622 missense probably benign 0.02
IGL01145:Rrm2b APN 15 37944560 missense probably damaging 0.96
norfolk UTSW 15 37937351 critical splice acceptor site probably null
rememberance UTSW 15 37946800 missense possibly damaging 0.65
PIT4515001:Rrm2b UTSW 15 37946804 missense probably benign
R0026:Rrm2b UTSW 15 37953741 missense probably benign 0.19
R0044:Rrm2b UTSW 15 37953688 missense possibly damaging 0.83
R0044:Rrm2b UTSW 15 37953688 missense possibly damaging 0.83
R0624:Rrm2b UTSW 15 37931645 missense probably benign 0.00
R1371:Rrm2b UTSW 15 37946809 missense probably benign 0.06
R1635:Rrm2b UTSW 15 37945084 missense probably damaging 1.00
R1692:Rrm2b UTSW 15 37927322 nonsense probably null
R1710:Rrm2b UTSW 15 37929096 missense probably damaging 1.00
R2273:Rrm2b UTSW 15 37945051 missense possibly damaging 0.92
R3196:Rrm2b UTSW 15 37945147 splice site probably null
R4459:Rrm2b UTSW 15 37945153 splice site probably null
R5310:Rrm2b UTSW 15 37927327 missense probably damaging 1.00
R5747:Rrm2b UTSW 15 37927390 missense probably benign
R7343:Rrm2b UTSW 15 37944573 missense probably benign 0.18
R7378:Rrm2b UTSW 15 37931647 missense probably benign
R7539:Rrm2b UTSW 15 37937351 critical splice acceptor site probably null
R8077:Rrm2b UTSW 15 37946800 missense possibly damaging 0.65
R8856:Rrm2b UTSW 15 37960614 intron probably benign
Predicted Primers PCR Primer
(F):5'- CAACAACAGGTTTCCATGTGTTTTG -3'
(R):5'- CTATGAAGTGGAGTCCTGCC -3'

Sequencing Primer
(F):5'- CCATGTGTTTTGTTTGTTTTCGC -3'
(R):5'- AAGTGGAGTCCTGCCCTCTG -3'
Posted On2019-11-26