Incidental Mutation 'R7797:Umodl1'
ID600316
Institutional Source Beutler Lab
Gene Symbol Umodl1
Ensembl Gene ENSMUSG00000054134
Gene Nameuromodulin-like 1
SynonymsD17Ertd488e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7797 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location30954679-31010708 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30959151 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 34 (S34G)
Ref Sequence ENSEMBL: ENSMUSP00000067443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066554] [ENSMUST00000066981] [ENSMUST00000114555]
Predicted Effect probably benign
Transcript: ENSMUST00000066554
AA Change: S34G

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000067443
Gene: ENSMUSG00000054134
AA Change: S34G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000066981
AA Change: S34G

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000065470
Gene: ENSMUSG00000054134
AA Change: S34G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 8.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 8.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 619 632 N/A INTRINSIC
SEA 706 821 8.88e-2 SMART
EGF 818 859 4.26e0 SMART
ZP 909 1152 5.44e-25 SMART
transmembrane domain 1186 1208 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114555
AA Change: S34G

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000110202
Gene: ENSMUSG00000054134
AA Change: S34G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 9.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 9.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (68/68)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T C 17: 33,067,690 D46G probably damaging Het
9230110C19Rik G T 9: 8,027,129 P136Q possibly damaging Het
Abca8b A G 11: 109,971,683 probably null Het
Adam3 T G 8: 24,694,644 N535T probably damaging Het
Adamts4 A G 1: 171,257,818 K679E probably damaging Het
Arnt G A 3: 95,480,261 probably null Het
Asah2 A G 19: 32,022,361 F321L probably damaging Het
Asb15 T C 6: 24,562,506 S156P probably damaging Het
Baiap2l1 A C 5: 144,318,950 S65A probably damaging Het
Bend7 T G 2: 4,749,644 M186R probably damaging Het
Blnk T C 19: 40,959,788 K146E possibly damaging Het
Cd19 A G 7: 126,413,508 W238R probably damaging Het
Cd44 T A 2: 102,848,734 N241I probably benign Het
Cdh23 T C 10: 60,385,194 E1257G probably benign Het
Cntnap5c T C 17: 58,359,275 V1100A probably benign Het
Cul7 T C 17: 46,658,642 V945A possibly damaging Het
Dock2 C T 11: 34,282,652 C1116Y probably damaging Het
Ehbp1 T C 11: 22,096,109 M547V possibly damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Gm5346 T A 8: 43,626,374 E271V probably benign Het
Grhl3 C G 4: 135,559,105 K88N possibly damaging Het
Hbb-y T A 7: 103,851,881 Y146F probably damaging Het
Hivep2 T C 10: 14,130,103 V815A probably benign Het
Hoxa7 T A 6: 52,215,890 I173F probably damaging Het
Igkv1-110 T G 6: 68,270,993 S29A probably benign Het
Jade2 A G 11: 51,817,299 S696P probably benign Het
Kif1b T A 4: 149,237,387 Q1025L probably benign Het
Kif2c A T 4: 117,171,743 C241S probably benign Het
Kmt2d G T 15: 98,864,406 H400N probably benign Het
Krt35 T A 11: 100,094,887 N174Y probably damaging Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Magi3 A G 3: 104,051,302 V489A probably damaging Het
Mapk7 T C 11: 61,489,415 E739G possibly damaging Het
Mcidas G A 13: 112,998,987 G315S probably damaging Het
Mdga1 C T 17: 29,842,840 probably null Het
Megf8 G A 7: 25,334,597 R607H probably damaging Het
Met T A 6: 17,533,953 N634K probably damaging Het
Miip C T 4: 147,862,918 G236S probably benign Het
Mmp11 G T 10: 75,923,480 T107K Het
Mroh2b A C 15: 4,949,105 N1378H probably benign Het
Naa15 G A 3: 51,448,610 C322Y probably damaging Het
Naip1 T A 13: 100,444,478 Y87F probably damaging Het
Ngrn A G 7: 80,264,437 D112G probably benign Het
Osbpl1a C A 18: 12,882,264 C369F probably damaging Het
Pcnx2 G C 8: 125,785,348 D1406E possibly damaging Het
Pold1 G A 7: 44,541,789 P206L probably benign Het
Psen1 A G 12: 83,699,622 S20G probably benign Het
Ptpn23 C T 9: 110,393,807 D61N possibly damaging Het
Rbfox3 A T 11: 118,496,484 L268Q possibly damaging Het
Rbm22 A G 18: 60,561,272 T26A probably damaging Het
Rpgrip1 G A 14: 52,133,820 R332Q possibly damaging Het
Rrm2b A T 15: 37,927,261 L347* probably null Het
Rsf1 A T 7: 97,661,485 D474V Het
Ryr2 C T 13: 11,801,180 R640Q probably damaging Het
Sec16b A G 1: 157,561,675 E691G unknown Het
Sept1 A T 7: 127,214,765 V365E unknown Het
Tlk2 A G 11: 105,210,618 H114R probably benign Het
Tmem200a A G 10: 25,993,966 I135T possibly damaging Het
Tpst2 T A 5: 112,307,916 V107E probably damaging Het
Trim30a A T 7: 104,411,200 D456E possibly damaging Het
Ttll3 T C 6: 113,394,777 V45A possibly damaging Het
Ulk2 A G 11: 61,782,102 Y889H probably benign Het
Vmn1r67 A G 7: 10,446,976 I56V probably benign Het
Vmn2r120 C T 17: 57,508,874 G827E probably damaging Het
Zc3h6 T C 2: 129,015,635 probably null Het
Other mutations in Umodl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Umodl1 APN 17 31008750 utr 3 prime probably benign
IGL01344:Umodl1 APN 17 30996264 missense probably damaging 0.99
IGL01529:Umodl1 APN 17 30996259 missense possibly damaging 0.94
IGL01609:Umodl1 APN 17 30998826 missense possibly damaging 0.90
IGL01625:Umodl1 APN 17 30996255 missense probably benign 0.00
IGL01877:Umodl1 APN 17 30982320 missense probably benign 0.00
IGL01977:Umodl1 APN 17 30973768 missense probably damaging 0.99
IGL02063:Umodl1 APN 17 30987914 missense probably benign 0.07
IGL02160:Umodl1 APN 17 30986117 missense probably damaging 0.97
IGL02252:Umodl1 APN 17 30994815 critical splice donor site probably null
IGL02427:Umodl1 APN 17 30968441 splice site probably benign
IGL02496:Umodl1 APN 17 30998654 missense probably damaging 0.99
IGL02633:Umodl1 APN 17 30989488 missense probably damaging 1.00
IGL03271:Umodl1 APN 17 30986499 nonsense probably null
IGL03392:Umodl1 APN 17 30996355 missense probably damaging 0.98
Disquieting UTSW 17 30959155 missense probably damaging 1.00
floored UTSW 17 30988057 nonsense probably null
R7231_umodl1_507 UTSW 17 30986116 missense probably damaging 1.00
surprising UTSW 17 30986465 missense possibly damaging 0.77
unsettling UTSW 17 30986554 nonsense probably null
G1citation:Umodl1 UTSW 17 30986554 nonsense probably null
PIT4468001:Umodl1 UTSW 17 30959278 missense probably damaging 1.00
R0048:Umodl1 UTSW 17 30968477 missense probably damaging 1.00
R0048:Umodl1 UTSW 17 30968477 missense probably damaging 1.00
R0653:Umodl1 UTSW 17 30984028 missense probably benign 0.00
R0831:Umodl1 UTSW 17 30996351 missense probably damaging 1.00
R1078:Umodl1 UTSW 17 30959373 missense probably benign 0.00
R1166:Umodl1 UTSW 17 31002798 splice site probably benign
R1231:Umodl1 UTSW 17 30959278 missense probably damaging 1.00
R1459:Umodl1 UTSW 17 30982258 splice site probably benign
R1459:Umodl1 UTSW 17 30986504 missense probably benign 0.05
R1510:Umodl1 UTSW 17 30959229 missense probably damaging 1.00
R1654:Umodl1 UTSW 17 30987968 missense probably benign
R1757:Umodl1 UTSW 17 31008700 missense probably damaging 0.99
R1781:Umodl1 UTSW 17 30968550 missense probably damaging 1.00
R1873:Umodl1 UTSW 17 30982264 missense probably damaging 0.99
R1911:Umodl1 UTSW 17 30992154 missense possibly damaging 0.74
R1917:Umodl1 UTSW 17 30984043 missense probably damaging 1.00
R1918:Umodl1 UTSW 17 30984043 missense probably damaging 1.00
R2057:Umodl1 UTSW 17 31008766 critical splice donor site probably null
R2058:Umodl1 UTSW 17 31008766 critical splice donor site probably null
R2089:Umodl1 UTSW 17 30971919 missense probably benign 0.00
R2091:Umodl1 UTSW 17 30971919 missense probably benign 0.00
R2091:Umodl1 UTSW 17 30971919 missense probably benign 0.00
R2431:Umodl1 UTSW 17 30992088 missense possibly damaging 0.79
R2903:Umodl1 UTSW 17 30992173 missense probably damaging 1.00
R3032:Umodl1 UTSW 17 30989528 missense probably benign 0.01
R3956:Umodl1 UTSW 17 31002863 missense probably benign 0.10
R3975:Umodl1 UTSW 17 30984789 nonsense probably null
R4207:Umodl1 UTSW 17 30959367 missense probably damaging 1.00
R4287:Umodl1 UTSW 17 30988065 missense probably benign 0.11
R4452:Umodl1 UTSW 17 30994815 critical splice donor site probably null
R4684:Umodl1 UTSW 17 30998114 missense probably benign 0.00
R4769:Umodl1 UTSW 17 30984002 missense possibly damaging 0.92
R4887:Umodl1 UTSW 17 31008665 missense probably benign 0.06
R4888:Umodl1 UTSW 17 30999201 missense probably damaging 1.00
R4978:Umodl1 UTSW 17 30986081 missense probably benign
R4993:Umodl1 UTSW 17 30986485 missense probably benign 0.00
R5241:Umodl1 UTSW 17 30984092 missense probably benign 0.18
R5254:Umodl1 UTSW 17 30980359 missense possibly damaging 0.86
R5454:Umodl1 UTSW 17 30986465 missense possibly damaging 0.77
R5456:Umodl1 UTSW 17 30982289 missense probably benign 0.04
R5754:Umodl1 UTSW 17 30994787 missense probably damaging 0.96
R6189:Umodl1 UTSW 17 30996282 missense possibly damaging 0.75
R6222:Umodl1 UTSW 17 31002892 critical splice donor site probably null
R6289:Umodl1 UTSW 17 30982351 missense probably benign 0.16
R6432:Umodl1 UTSW 17 30986147 missense probably benign 0.38
R6478:Umodl1 UTSW 17 30959155 missense probably damaging 1.00
R6702:Umodl1 UTSW 17 30986299 splice site probably null
R6822:Umodl1 UTSW 17 30986554 nonsense probably null
R6999:Umodl1 UTSW 17 30999123 missense probably damaging 1.00
R7067:Umodl1 UTSW 17 30982272 missense probably damaging 1.00
R7123:Umodl1 UTSW 17 30982344 missense possibly damaging 0.90
R7219:Umodl1 UTSW 17 30982262 critical splice acceptor site probably null
R7231:Umodl1 UTSW 17 30986116 missense probably damaging 1.00
R7234:Umodl1 UTSW 17 30986621 missense possibly damaging 0.87
R7297:Umodl1 UTSW 17 31008665 missense probably benign 0.06
R7392:Umodl1 UTSW 17 30982332 missense probably damaging 0.99
R7401:Umodl1 UTSW 17 30998148 missense probably damaging 1.00
R7461:Umodl1 UTSW 17 30988057 nonsense probably null
R7594:Umodl1 UTSW 17 30954805 missense probably benign 0.02
R7613:Umodl1 UTSW 17 30988057 nonsense probably null
R7763:Umodl1 UTSW 17 30986456 missense probably benign 0.24
R7832:Umodl1 UTSW 17 30973692 critical splice acceptor site probably null
R7954:Umodl1 UTSW 17 30986387 missense probably benign 0.00
R8088:Umodl1 UTSW 17 30973796 missense probably benign 0.29
R8111:Umodl1 UTSW 17 30971818 missense probably damaging 0.99
R8314:Umodl1 UTSW 17 30984832 missense probably damaging 0.99
R8826:Umodl1 UTSW 17 30983984 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- ACAGGCTAATGTCAATGGCTATG -3'
(R):5'- TCGGTCACATTCCTGGACTC -3'

Sequencing Primer
(F):5'- GCCACACTAGGACTGTTGG -3'
(R):5'- TCAGGGACATCCATCGCTAG -3'
Posted On2019-11-26