Incidental Mutation 'R7798:Il1r1'
ID600325
Institutional Source Beutler Lab
Gene Symbol Il1r1
Ensembl Gene ENSMUSG00000026072
Gene Nameinterleukin 1 receptor, type I
SynonymsIL-1R1, IL-iR, CD121a, IL-1 receptor alpha chain, Il1r-1
MMRRC Submission
Accession Numbers

Genbank: NM_008362, NM_001123382

Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R7798 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location40225080-40317257 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 40310366 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 361 (V361I)
Ref Sequence ENSEMBL: ENSMUSP00000027241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027241] [ENSMUST00000114795]
PDB Structure
[]
Predicted Effect probably benign
Transcript: ENSMUST00000027241
AA Change: V361I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027241
Gene: ENSMUSG00000026072
AA Change: V361I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 38 117 2.94e-1 SMART
IG_like 132 218 5.56e0 SMART
IG 236 333 1.35e0 SMART
Blast:TIR 347 381 1e-7 BLAST
TIR 387 544 1.93e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114795
AA Change: V358I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110443
Gene: ENSMUSG00000026072
AA Change: V358I

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 35 114 2.94e-1 SMART
IG_like 129 215 5.56e0 SMART
IG 233 330 1.35e0 SMART
Blast:TIR 344 378 1e-7 BLAST
TIR 384 541 1.93e-29 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytokine receptor that belongs to the interleukin-1 receptor family. The encoded protein is a receptor for interleukin-1 alpha, interleukin-1 beta, and interleukin-1 receptor antagonist. It is an important mediator involved in many cytokine-induced immune and inflammatory responses. This gene is located in a cluster of related cytokine receptor genes on chromosome 2q12. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to bacterial infection, reduced IL1b responsiveness, delayed tooth eruption, decreased susceptibility to experimental autoimmune uveoritinitis, decreased susceptibility to kidney reperfusion injury, and late onset obesity. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(2) Gene trapped(1)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700088E04Rik T A 15: 79,135,732 N128I probably damaging Het
5830473C10Rik T C 5: 90,597,511 S608P possibly damaging Het
Abca13 A G 11: 9,291,664 T1176A probably benign Het
Abca9 A G 11: 110,138,179 V851A probably benign Het
Abcc6 C A 7: 45,976,853 E1494* probably null Het
Adamts14 A T 10: 61,271,173 V56E probably damaging Het
Adamts15 G A 9: 30,904,643 T639M probably damaging Het
Arhgap11a A C 2: 113,843,335 V70G probably damaging Het
BC051665 A T 13: 60,784,435 D113E probably benign Het
Best1 T C 19: 9,991,671 Y227C probably damaging Het
Camk2b A G 11: 5,978,399 S447P probably benign Het
Ccdc88a C A 11: 29,477,348 Q1018K probably benign Het
Cfap74 T A 4: 155,422,622 V180D Het
Clca3a1 T A 3: 144,757,962 T185S probably damaging Het
Clca3b T C 3: 144,828,130 S495G probably damaging Het
Cyb5r2 A T 7: 107,753,948 Y96N possibly damaging Het
Cyp21a1 T C 17: 34,804,321 K27E probably benign Het
Cyp2ab1 T C 16: 20,312,416 E321G probably benign Het
Des T C 1: 75,362,359 I228T probably damaging Het
Dis3l G T 9: 64,341,017 P39T probably benign Het
Disp2 A C 2: 118,791,879 I1031L probably benign Het
Ell3 TCTCCTC TCTC 2: 121,439,456 probably benign Het
Etl4 G A 2: 20,781,946 probably null Het
Fgf23 A T 6: 127,073,214 D62V probably damaging Het
Galnt15 C T 14: 32,029,905 T138I possibly damaging Het
Ggt6 A T 11: 72,435,541 probably benign Het
Gm28710 T C 5: 16,856,658 F801L possibly damaging Het
Gm9573 C G 17: 35,621,254 G680A unknown Het
Gpr180 T A 14: 118,153,686 V209D probably damaging Het
Gzma A T 13: 113,096,324 F78Y probably benign Het
Igkv8-30 A T 6: 70,117,371 C19S probably benign Het
Intu T C 3: 40,691,929 V598A probably damaging Het
Itpr2 A G 6: 146,386,015 F471L probably benign Het
Kntc1 T A 5: 123,786,294 V1081E probably benign Het
Kntc1 T A 5: 123,819,117 V2163E possibly damaging Het
Macf1 T C 4: 123,378,100 K6552E probably damaging Het
Marf1 T C 16: 14,138,451 H842R probably benign Het
Mgat4b A G 11: 50,225,670 T10A possibly damaging Het
Muc5ac T C 7: 141,794,041 probably null Het
Nrk CGCAGCAGCAGCAGCAGCAGC CGCAGCAGCAGCAGCAGC X: 138,982,677 probably benign Het
Nsun4 T G 4: 116,051,174 S730R possibly damaging Het
Olfr1112 A T 2: 87,192,292 I202L probably benign Het
Olfr1310 A G 2: 112,008,272 F305L probably benign Het
Olfr351 T C 2: 36,860,336 E4G probably benign Het
Olfr360 A T 2: 37,069,174 S290C probably damaging Het
Olfr727 A T 14: 50,127,438 Y287F probably damaging Het
Padi3 C T 4: 140,786,439 E653K probably benign Het
Pde4a A G 9: 21,198,663 E280G possibly damaging Het
Phactr3 G A 2: 178,283,910 R326H probably benign Het
Prob1 G A 18: 35,653,344 P619L possibly damaging Het
Ptk2 G A 15: 73,295,375 R368W probably damaging Het
Rgs6 A G 12: 83,069,519 T240A probably benign Het
Rpa1 A T 11: 75,312,809 Y356N probably damaging Het
Rxrb T A 17: 34,033,605 D165E probably damaging Het
Sco1 A G 11: 67,053,802 T84A possibly damaging Het
Sepsecs T C 5: 52,647,189 I380V probably benign Het
Sfmbt1 T A 14: 30,816,802 W793R probably damaging Het
Slco3a1 A G 7: 74,318,596 S459P probably benign Het
Smg1 A T 7: 118,171,939 S1503R possibly damaging Het
Sox2 G A 3: 34,650,642 R76H probably damaging Het
Spty2d1 G A 7: 46,996,056 S613F probably damaging Het
Stab2 A T 10: 86,957,912 Y440N probably damaging Het
Syn3 A G 10: 86,080,253 Y290H probably damaging Het
Tex15 C T 8: 33,581,847 S2474F possibly damaging Het
Tgtp1 A G 11: 48,987,332 F182S probably benign Het
Tmcc1 A T 6: 116,043,578 S304R Het
Tmem130 T G 5: 144,743,770 K275Q probably damaging Het
Tmem9 C A 1: 136,034,189 T174K probably damaging Het
Ttyh3 C T 5: 140,634,783 R233Q probably damaging Het
Twnk T C 19: 45,007,668 M180T probably benign Het
Ube4a A G 9: 44,933,331 V874A probably damaging Het
Ugt2a3 T C 5: 87,327,723 N350S probably damaging Het
Vegfa C T 17: 46,031,835 G19D probably damaging Het
Vmn2r2 C A 3: 64,134,097 C399F possibly damaging Het
Vmn2r65 G T 7: 84,946,322 P385T probably benign Het
Vmn2r65 A G 7: 84,946,984 F164S probably damaging Het
Zcchc6 A T 13: 59,815,575 M323K possibly damaging Het
Other mutations in Il1r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01457:Il1r1 APN 1 40313170 missense probably damaging 1.00
IGL01532:Il1r1 APN 1 40294928 critical splice donor site probably null
IGL01610:Il1r1 APN 1 40302400 missense probably benign 0.09
IGL01668:Il1r1 APN 1 40313329 missense probably benign 0.31
IGL01729:Il1r1 APN 1 40294826 missense probably damaging 1.00
IGL02201:Il1r1 APN 1 40313268 missense probably damaging 0.97
IGL02229:Il1r1 APN 1 40313358 missense probably damaging 0.99
IGL02428:Il1r1 APN 1 40313232 missense possibly damaging 0.74
IGL02902:Il1r1 APN 1 40302409 missense probably benign 0.09
G5030:Il1r1 UTSW 1 40313163 missense possibly damaging 0.80
R0604:Il1r1 UTSW 1 40282246 missense probably benign 0.36
R1515:Il1r1 UTSW 1 40293349 nonsense probably null
R1530:Il1r1 UTSW 1 40312361 missense probably benign 0.00
R1727:Il1r1 UTSW 1 40293264 missense probably benign 0.16
R1957:Il1r1 UTSW 1 40313140 nonsense probably null
R2163:Il1r1 UTSW 1 40294863 missense probably benign 0.00
R2313:Il1r1 UTSW 1 40313310 missense probably benign 0.19
R4345:Il1r1 UTSW 1 40297924 missense probably benign 0.00
R4622:Il1r1 UTSW 1 40312420 missense probably damaging 0.96
R4735:Il1r1 UTSW 1 40293295 missense probably benign 0.00
R5033:Il1r1 UTSW 1 40293524 missense probably damaging 1.00
R5586:Il1r1 UTSW 1 40225251 start gained probably benign
R6375:Il1r1 UTSW 1 40294890 missense probably damaging 1.00
R6383:Il1r1 UTSW 1 40313335 missense possibly damaging 0.58
R6618:Il1r1 UTSW 1 40300811 missense probably damaging 0.97
R7169:Il1r1 UTSW 1 40293359 critical splice donor site probably null
R7384:Il1r1 UTSW 1 40282261 missense possibly damaging 0.64
R8040:Il1r1 UTSW 1 40313349 missense probably benign 0.01
RF007:Il1r1 UTSW 1 40313278 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCATTTGTGGTCATTGGTACC -3'
(R):5'- TGCCAATATGGAAGCTAGGGTG -3'

Sequencing Primer
(F):5'- TGGTACCAGTGACCTGAATATAC -3'
(R):5'- ACATGAGTGGTATCAAGGCATATC -3'
Posted On2019-11-26