Incidental Mutation 'R7798:Arhgap11a'
ID600333
Institutional Source Beutler Lab
Gene Symbol Arhgap11a
Ensembl Gene ENSMUSG00000041219
Gene NameRho GTPase activating protein 11A
SynonymsGAP (1-12), 6530401L14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7798 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location113831492-113848661 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 113843335 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 70 (V70G)
Ref Sequence ENSEMBL: ENSMUSP00000106573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102545] [ENSMUST00000110947] [ENSMUST00000110948] [ENSMUST00000110949]
Predicted Effect probably damaging
Transcript: ENSMUST00000102545
AA Change: V70G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099604
Gene: ENSMUSG00000041219
AA Change: V70G

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
RhoGAP 63 236 1.97e-47 SMART
Blast:RhoGAP 288 349 3e-20 BLAST
low complexity region 490 501 N/A INTRINSIC
low complexity region 719 738 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110947
AA Change: V70G

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106572
Gene: ENSMUSG00000041219
AA Change: V70G

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
RhoGAP 63 236 1.97e-47 SMART
Blast:RhoGAP 288 349 7e-21 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000110948
AA Change: V70G

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106573
Gene: ENSMUSG00000041219
AA Change: V70G

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
RhoGAP 63 236 1.97e-47 SMART
Blast:RhoGAP 288 349 6e-21 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000110949
AA Change: V70G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106574
Gene: ENSMUSG00000041219
AA Change: V70G

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
RhoGAP 63 236 1.97e-47 SMART
Blast:RhoGAP 288 349 3e-20 BLAST
low complexity region 490 501 N/A INTRINSIC
low complexity region 719 738 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rho GTPase activating protein family. In response to DNA damage, the encoded protein interacts with the p53 tumor suppressor protein and stimulates its tetramerization, which results in cell-cycle arrest and apoptosis. A chromosomal deletion that includes this gene is one cause of Prader-Willi syndrome, and an intronic variant of this gene may be associated with sleep duration in children. This gene is highly expressed in colon cancers and in a human basal-like breast cancer cell line. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700088E04Rik T A 15: 79,135,732 N128I probably damaging Het
5830473C10Rik T C 5: 90,597,511 S608P possibly damaging Het
Abca13 A G 11: 9,291,664 T1176A probably benign Het
Abca9 A G 11: 110,138,179 V851A probably benign Het
Abcc6 C A 7: 45,976,853 E1494* probably null Het
Adamts14 A T 10: 61,271,173 V56E probably damaging Het
Adamts15 G A 9: 30,904,643 T639M probably damaging Het
BC051665 A T 13: 60,784,435 D113E probably benign Het
Best1 T C 19: 9,991,671 Y227C probably damaging Het
Camk2b A G 11: 5,978,399 S447P probably benign Het
Ccdc88a C A 11: 29,477,348 Q1018K probably benign Het
Cfap74 T A 4: 155,422,622 V180D Het
Clca3a1 T A 3: 144,757,962 T185S probably damaging Het
Clca3b T C 3: 144,828,130 S495G probably damaging Het
Cyb5r2 A T 7: 107,753,948 Y96N possibly damaging Het
Cyp21a1 T C 17: 34,804,321 K27E probably benign Het
Cyp2ab1 T C 16: 20,312,416 E321G probably benign Het
Des T C 1: 75,362,359 I228T probably damaging Het
Dis3l G T 9: 64,341,017 P39T probably benign Het
Disp2 A C 2: 118,791,879 I1031L probably benign Het
Ell3 TCTCCTC TCTC 2: 121,439,456 probably benign Het
Etl4 G A 2: 20,781,946 probably null Het
Fgf23 A T 6: 127,073,214 D62V probably damaging Het
Galnt15 C T 14: 32,029,905 T138I possibly damaging Het
Ggt6 A T 11: 72,435,541 probably benign Het
Gm28710 T C 5: 16,856,658 F801L possibly damaging Het
Gm9573 C G 17: 35,621,254 G680A unknown Het
Gpr180 T A 14: 118,153,686 V209D probably damaging Het
Gzma A T 13: 113,096,324 F78Y probably benign Het
Igkv8-30 A T 6: 70,117,371 C19S probably benign Het
Il1r1 G A 1: 40,310,366 V361I probably benign Het
Intu T C 3: 40,691,929 V598A probably damaging Het
Itpr2 A G 6: 146,386,015 F471L probably benign Het
Kntc1 T A 5: 123,786,294 V1081E probably benign Het
Kntc1 T A 5: 123,819,117 V2163E possibly damaging Het
Macf1 T C 4: 123,378,100 K6552E probably damaging Het
Marf1 T C 16: 14,138,451 H842R probably benign Het
Mgat4b A G 11: 50,225,670 T10A possibly damaging Het
Muc5ac T C 7: 141,794,041 probably null Het
Nrk CGCAGCAGCAGCAGCAGCAGC CGCAGCAGCAGCAGCAGC X: 138,982,677 probably benign Het
Nsun4 T G 4: 116,051,174 S730R possibly damaging Het
Olfr1112 A T 2: 87,192,292 I202L probably benign Het
Olfr1310 A G 2: 112,008,272 F305L probably benign Het
Olfr351 T C 2: 36,860,336 E4G probably benign Het
Olfr360 A T 2: 37,069,174 S290C probably damaging Het
Olfr727 A T 14: 50,127,438 Y287F probably damaging Het
Padi3 C T 4: 140,786,439 E653K probably benign Het
Pde4a A G 9: 21,198,663 E280G possibly damaging Het
Phactr3 G A 2: 178,283,910 R326H probably benign Het
Prob1 G A 18: 35,653,344 P619L possibly damaging Het
Ptk2 G A 15: 73,295,375 R368W probably damaging Het
Rgs6 A G 12: 83,069,519 T240A probably benign Het
Rpa1 A T 11: 75,312,809 Y356N probably damaging Het
Rxrb T A 17: 34,033,605 D165E probably damaging Het
Sco1 A G 11: 67,053,802 T84A possibly damaging Het
Sepsecs T C 5: 52,647,189 I380V probably benign Het
Sfmbt1 T A 14: 30,816,802 W793R probably damaging Het
Slco3a1 A G 7: 74,318,596 S459P probably benign Het
Smg1 A T 7: 118,171,939 S1503R possibly damaging Het
Sox2 G A 3: 34,650,642 R76H probably damaging Het
Spty2d1 G A 7: 46,996,056 S613F probably damaging Het
Stab2 A T 10: 86,957,912 Y440N probably damaging Het
Syn3 A G 10: 86,080,253 Y290H probably damaging Het
Tex15 C T 8: 33,581,847 S2474F possibly damaging Het
Tgtp1 A G 11: 48,987,332 F182S probably benign Het
Tmcc1 A T 6: 116,043,578 S304R Het
Tmem130 T G 5: 144,743,770 K275Q probably damaging Het
Tmem9 C A 1: 136,034,189 T174K probably damaging Het
Ttyh3 C T 5: 140,634,783 R233Q probably damaging Het
Twnk T C 19: 45,007,668 M180T probably benign Het
Ube4a A G 9: 44,933,331 V874A probably damaging Het
Ugt2a3 T C 5: 87,327,723 N350S probably damaging Het
Vegfa C T 17: 46,031,835 G19D probably damaging Het
Vmn2r2 C A 3: 64,134,097 C399F possibly damaging Het
Vmn2r65 G T 7: 84,946,322 P385T probably benign Het
Vmn2r65 A G 7: 84,946,984 F164S probably damaging Het
Zcchc6 A T 13: 59,815,575 M323K possibly damaging Het
Other mutations in Arhgap11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Arhgap11a APN 2 113834256 missense probably benign 0.00
IGL00337:Arhgap11a APN 2 113841942 missense probably damaging 0.96
IGL00532:Arhgap11a APN 2 113834066 missense probably benign
IGL00869:Arhgap11a APN 2 113834826 missense probably damaging 0.99
IGL01123:Arhgap11a APN 2 113834773 splice site probably benign
IGL01353:Arhgap11a APN 2 113833524 missense probably damaging 1.00
IGL01725:Arhgap11a APN 2 113837552 missense probably damaging 0.98
IGL01911:Arhgap11a APN 2 113840732 missense probably damaging 1.00
IGL02077:Arhgap11a APN 2 113837471 missense possibly damaging 0.94
IGL02532:Arhgap11a APN 2 113833676 nonsense probably null
IGL02553:Arhgap11a APN 2 113837561 splice site probably benign
IGL02738:Arhgap11a APN 2 113832975 makesense probably null
IGL02945:Arhgap11a APN 2 113837473 missense possibly damaging 0.83
R0480:Arhgap11a UTSW 2 113839818 missense probably benign 0.03
R0515:Arhgap11a UTSW 2 113837471 missense possibly damaging 0.48
R0625:Arhgap11a UTSW 2 113841711 missense probably benign 0.01
R0898:Arhgap11a UTSW 2 113836876 missense probably benign 0.01
R1248:Arhgap11a UTSW 2 113834102 missense possibly damaging 0.63
R1395:Arhgap11a UTSW 2 113833122 missense probably benign 0.00
R1669:Arhgap11a UTSW 2 113841912 missense possibly damaging 0.92
R2915:Arhgap11a UTSW 2 113833508 missense probably damaging 1.00
R3941:Arhgap11a UTSW 2 113836897 missense probably damaging 1.00
R4194:Arhgap11a UTSW 2 113841994 missense probably benign 0.02
R4508:Arhgap11a UTSW 2 113842042 missense probably damaging 1.00
R4617:Arhgap11a UTSW 2 113834078 missense probably benign 0.01
R4839:Arhgap11a UTSW 2 113842029 missense probably damaging 1.00
R4842:Arhgap11a UTSW 2 113839762 missense probably damaging 0.98
R5507:Arhgap11a UTSW 2 113841678 missense probably benign
R5538:Arhgap11a UTSW 2 113837530 missense probably benign
R5660:Arhgap11a UTSW 2 113841910 missense possibly damaging 0.80
R5712:Arhgap11a UTSW 2 113845301 missense probably benign 0.09
R5849:Arhgap11a UTSW 2 113834847 missense probably null 0.01
R5856:Arhgap11a UTSW 2 113833771 missense possibly damaging 0.63
R6101:Arhgap11a UTSW 2 113834874 nonsense probably null
R6119:Arhgap11a UTSW 2 113834350 missense probably benign
R6338:Arhgap11a UTSW 2 113833725 missense probably benign 0.37
R6563:Arhgap11a UTSW 2 113833902 missense probably benign 0.00
R6919:Arhgap11a UTSW 2 113839709 missense possibly damaging 0.94
R7819:Arhgap11a UTSW 2 113834918 critical splice acceptor site probably null
X0065:Arhgap11a UTSW 2 113834231 missense probably benign 0.41
Z1088:Arhgap11a UTSW 2 113842894 missense probably damaging 1.00
Z1176:Arhgap11a UTSW 2 113833758 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- ACAGATGCAAGAATCTTGAGCC -3'
(R):5'- CGTTGACACTGTCATGAGTAAAGC -3'

Sequencing Primer
(F):5'- GCAAGAATCTTGAGCCTTCTAAAATC -3'
(R):5'- CACTGTCATGAGTAAAGCTGTAGACC -3'
Posted On2019-11-26