Incidental Mutation 'R7798:Sox2'
ID600337
Institutional Source Beutler Lab
Gene Symbol Sox2
Ensembl Gene ENSMUSG00000074637
Gene NameSRY (sex determining region Y)-box 2
Synonymsysb, Sox-2, lcc
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7798 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location34650405-34652461 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 34650642 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 76 (R76H)
Ref Sequence ENSEMBL: ENSMUSP00000096755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099151]
Predicted Effect probably damaging
Transcript: ENSMUST00000099151
AA Change: R76H

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000096755
Gene: ENSMUSG00000074637
AA Change: R76H

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
HMG 42 112 1.8e-28 SMART
low complexity region 137 156 N/A INTRINSIC
low complexity region 248 263 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: This intronless gene encodes a member of the SRY-related HMG-box (SOX) family of transcription factors involved in the regulation of embryonic development and in the determination of cell fate. The product of this gene is required for stem-cell maintenance in the central nervous system, and also regulates gene expression in the stomach. Mutations in a similar gene in human have been associated with optic nerve hypoplasia and with syndromic microphthalmia, a severe form of structural eye malformation. This gene lies within an intron of another gene called SOX2 overlapping transcript (Sox2ot). [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for targeted null mutations implant but fail to develop an egg cylinder or epiblast, and die shortly thereafter. Other mutations that affect only regulatory elements show circling behavior and deafness, inner ear defects, and a yellow coat color. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700088E04Rik T A 15: 79,135,732 N128I probably damaging Het
5830473C10Rik T C 5: 90,597,511 S608P possibly damaging Het
Abca13 A G 11: 9,291,664 T1176A probably benign Het
Abca9 A G 11: 110,138,179 V851A probably benign Het
Abcc6 C A 7: 45,976,853 E1494* probably null Het
Adamts14 A T 10: 61,271,173 V56E probably damaging Het
Adamts15 G A 9: 30,904,643 T639M probably damaging Het
Arhgap11a A C 2: 113,843,335 V70G probably damaging Het
BC051665 A T 13: 60,784,435 D113E probably benign Het
Best1 T C 19: 9,991,671 Y227C probably damaging Het
Camk2b A G 11: 5,978,399 S447P probably benign Het
Ccdc88a C A 11: 29,477,348 Q1018K probably benign Het
Cfap74 T A 4: 155,422,622 V180D Het
Clca3a1 T A 3: 144,757,962 T185S probably damaging Het
Clca3b T C 3: 144,828,130 S495G probably damaging Het
Cyb5r2 A T 7: 107,753,948 Y96N possibly damaging Het
Cyp21a1 T C 17: 34,804,321 K27E probably benign Het
Cyp2ab1 T C 16: 20,312,416 E321G probably benign Het
Des T C 1: 75,362,359 I228T probably damaging Het
Dis3l G T 9: 64,341,017 P39T probably benign Het
Disp2 A C 2: 118,791,879 I1031L probably benign Het
Ell3 TCTCCTC TCTC 2: 121,439,456 probably benign Het
Etl4 G A 2: 20,781,946 probably null Het
Fgf23 A T 6: 127,073,214 D62V probably damaging Het
Galnt15 C T 14: 32,029,905 T138I possibly damaging Het
Ggt6 A T 11: 72,435,541 probably benign Het
Gm28710 T C 5: 16,856,658 F801L possibly damaging Het
Gm9573 C G 17: 35,621,254 G680A unknown Het
Gpr180 T A 14: 118,153,686 V209D probably damaging Het
Gzma A T 13: 113,096,324 F78Y probably benign Het
Igkv8-30 A T 6: 70,117,371 C19S probably benign Het
Il1r1 G A 1: 40,310,366 V361I probably benign Het
Intu T C 3: 40,691,929 V598A probably damaging Het
Itpr2 A G 6: 146,386,015 F471L probably benign Het
Kntc1 T A 5: 123,786,294 V1081E probably benign Het
Kntc1 T A 5: 123,819,117 V2163E possibly damaging Het
Macf1 T C 4: 123,378,100 K6552E probably damaging Het
Marf1 T C 16: 14,138,451 H842R probably benign Het
Mgat4b A G 11: 50,225,670 T10A possibly damaging Het
Muc5ac T C 7: 141,794,041 probably null Het
Nrk CGCAGCAGCAGCAGCAGCAGC CGCAGCAGCAGCAGCAGC X: 138,982,677 probably benign Het
Nsun4 T G 4: 116,051,174 S730R possibly damaging Het
Olfr1112 A T 2: 87,192,292 I202L probably benign Het
Olfr1310 A G 2: 112,008,272 F305L probably benign Het
Olfr351 T C 2: 36,860,336 E4G probably benign Het
Olfr360 A T 2: 37,069,174 S290C probably damaging Het
Olfr727 A T 14: 50,127,438 Y287F probably damaging Het
Padi3 C T 4: 140,786,439 E653K probably benign Het
Pde4a A G 9: 21,198,663 E280G possibly damaging Het
Phactr3 G A 2: 178,283,910 R326H probably benign Het
Prob1 G A 18: 35,653,344 P619L possibly damaging Het
Ptk2 G A 15: 73,295,375 R368W probably damaging Het
Rgs6 A G 12: 83,069,519 T240A probably benign Het
Rpa1 A T 11: 75,312,809 Y356N probably damaging Het
Rxrb T A 17: 34,033,605 D165E probably damaging Het
Sco1 A G 11: 67,053,802 T84A possibly damaging Het
Sepsecs T C 5: 52,647,189 I380V probably benign Het
Sfmbt1 T A 14: 30,816,802 W793R probably damaging Het
Slco3a1 A G 7: 74,318,596 S459P probably benign Het
Smg1 A T 7: 118,171,939 S1503R possibly damaging Het
Spty2d1 G A 7: 46,996,056 S613F probably damaging Het
Stab2 A T 10: 86,957,912 Y440N probably damaging Het
Syn3 A G 10: 86,080,253 Y290H probably damaging Het
Tex15 C T 8: 33,581,847 S2474F possibly damaging Het
Tgtp1 A G 11: 48,987,332 F182S probably benign Het
Tmcc1 A T 6: 116,043,578 S304R Het
Tmem130 T G 5: 144,743,770 K275Q probably damaging Het
Tmem9 C A 1: 136,034,189 T174K probably damaging Het
Ttyh3 C T 5: 140,634,783 R233Q probably damaging Het
Twnk T C 19: 45,007,668 M180T probably benign Het
Ube4a A G 9: 44,933,331 V874A probably damaging Het
Ugt2a3 T C 5: 87,327,723 N350S probably damaging Het
Vegfa C T 17: 46,031,835 G19D probably damaging Het
Vmn2r2 C A 3: 64,134,097 C399F possibly damaging Het
Vmn2r65 G T 7: 84,946,322 P385T probably benign Het
Vmn2r65 A G 7: 84,946,984 F164S probably damaging Het
Zcchc6 A T 13: 59,815,575 M323K possibly damaging Het
Other mutations in Sox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02578:Sox2 APN 3 34650596 missense probably benign 0.37
IGL03397:Sox2 APN 3 34650537 missense probably damaging 0.99
R1164:Sox2 UTSW 3 34650699 missense probably damaging 1.00
R1667:Sox2 UTSW 3 34650419 missense probably damaging 1.00
R1829:Sox2 UTSW 3 34650741 missense probably damaging 0.99
R1925:Sox2 UTSW 3 34650671 nonsense probably null
R2066:Sox2 UTSW 3 34651307 missense possibly damaging 0.63
R4170:Sox2 UTSW 3 34650554 missense probably damaging 0.99
R4585:Sox2 UTSW 3 34651044 missense probably benign 0.02
R4586:Sox2 UTSW 3 34651044 missense probably benign 0.02
R4703:Sox2 UTSW 3 34650713 missense probably damaging 1.00
R5509:Sox2 UTSW 3 34650789 missense probably damaging 0.98
R5549:Sox2 UTSW 3 34650993 missense probably benign 0.01
R5637:Sox2 UTSW 3 34650528 missense probably benign 0.03
R6494:Sox2 UTSW 3 34651097 missense probably benign 0.01
R7117:Sox2 UTSW 3 34650926 missense possibly damaging 0.95
R7210:Sox2 UTSW 3 34651157 missense probably damaging 1.00
R7365:Sox2 UTSW 3 34650972 missense possibly damaging 0.60
R7801:Sox2 UTSW 3 34650642 missense probably damaging 0.96
X0024:Sox2 UTSW 3 34650689 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAATCACAACAATCGCGGCG -3'
(R):5'- TTGCTCCAGCCGTTCATGTG -3'

Sequencing Primer
(F):5'- AGCGCCCGCATGTATAAC -3'
(R):5'- CCGTTCATGTGCGCGTAG -3'
Posted On2019-11-26