Incidental Mutation 'R7798:Clca3b'
ID 600341
Institutional Source Beutler Lab
Gene Symbol Clca3b
Ensembl Gene ENSMUSG00000037033
Gene Name chloride channel accessory 3B
Synonyms Clca4
MMRRC Submission 045648-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R7798 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 144528384-144555063 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 144533891 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 495 (S495G)
Ref Sequence ENSEMBL: ENSMUSP00000124581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159989]
AlphaFold E9PUL3
Predicted Effect probably damaging
Transcript: ENSMUST00000159989
AA Change: S495G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124581
Gene: ENSMUSG00000037033
AA Change: S495G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 481 6.22e-19 SMART
FN3 762 861 4.93e0 SMART
low complexity region 880 1025 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700088E04Rik T A 15: 79,019,932 (GRCm39) N128I probably damaging Het
Abca13 A G 11: 9,241,664 (GRCm39) T1176A probably benign Het
Abca9 A G 11: 110,029,005 (GRCm39) V851A probably benign Het
Abcc6 C A 7: 45,626,277 (GRCm39) E1494* probably null Het
Adamts14 A T 10: 61,106,952 (GRCm39) V56E probably damaging Het
Adamts15 G A 9: 30,815,939 (GRCm39) T639M probably damaging Het
Albfm1 T C 5: 90,745,370 (GRCm39) S608P possibly damaging Het
Arhgap11a A C 2: 113,673,680 (GRCm39) V70G probably damaging Het
BC051665 A T 13: 60,932,249 (GRCm39) D113E probably benign Het
Best1 T C 19: 9,969,035 (GRCm39) Y227C probably damaging Het
Camk2b A G 11: 5,928,399 (GRCm39) S447P probably benign Het
Ccdc88a C A 11: 29,427,348 (GRCm39) Q1018K probably benign Het
Cdhr17 T C 5: 17,061,656 (GRCm39) F801L possibly damaging Het
Cfap74 T A 4: 155,507,079 (GRCm39) V180D Het
Clca3a1 T A 3: 144,463,723 (GRCm39) T185S probably damaging Het
Cyb5r2 A T 7: 107,353,155 (GRCm39) Y96N possibly damaging Het
Cyp21a1 T C 17: 35,023,295 (GRCm39) K27E probably benign Het
Cyp2ab1 T C 16: 20,131,166 (GRCm39) E321G probably benign Het
Des T C 1: 75,339,003 (GRCm39) I228T probably damaging Het
Dis3l G T 9: 64,248,299 (GRCm39) P39T probably benign Het
Disp2 A C 2: 118,622,360 (GRCm39) I1031L probably benign Het
Ell3 TCTCCTC TCTC 2: 121,269,937 (GRCm39) probably benign Het
Etl4 G A 2: 20,786,757 (GRCm39) probably null Het
Fgf23 A T 6: 127,050,177 (GRCm39) D62V probably damaging Het
Galnt15 C T 14: 31,751,862 (GRCm39) T138I possibly damaging Het
Ggt6 A T 11: 72,326,367 (GRCm39) probably benign Het
Gpr180 T A 14: 118,391,098 (GRCm39) V209D probably damaging Het
Gzma A T 13: 113,232,858 (GRCm39) F78Y probably benign Het
Igkv8-30 A T 6: 70,094,355 (GRCm39) C19S probably benign Het
Il1r1 G A 1: 40,349,526 (GRCm39) V361I probably benign Het
Intu T C 3: 40,646,359 (GRCm39) V598A probably damaging Het
Itpr2 A G 6: 146,287,513 (GRCm39) F471L probably benign Het
Kntc1 T A 5: 123,924,357 (GRCm39) V1081E probably benign Het
Kntc1 T A 5: 123,957,180 (GRCm39) V2163E possibly damaging Het
Macf1 T C 4: 123,271,893 (GRCm39) K6552E probably damaging Het
Marf1 T C 16: 13,956,315 (GRCm39) H842R probably benign Het
Mgat4b A G 11: 50,116,497 (GRCm39) T10A possibly damaging Het
Muc21 C G 17: 35,932,146 (GRCm39) G680A unknown Het
Muc5ac T C 7: 141,347,778 (GRCm39) probably null Het
Nrk CGCAGCAGCAGCAGCAGCAGC CGCAGCAGCAGCAGCAGC X: 137,883,426 (GRCm39) probably benign Het
Nsun4 T G 4: 115,908,371 (GRCm39) S730R possibly damaging Het
Or12e1 A T 2: 87,022,636 (GRCm39) I202L probably benign Het
Or12k7 A T 2: 36,959,186 (GRCm39) S290C probably damaging Het
Or1n1 T C 2: 36,750,348 (GRCm39) E4G probably benign Het
Or4f6 A G 2: 111,838,617 (GRCm39) F305L probably benign Het
Or4k15 A T 14: 50,364,895 (GRCm39) Y287F probably damaging Het
Padi3 C T 4: 140,513,750 (GRCm39) E653K probably benign Het
Pde4a A G 9: 21,109,959 (GRCm39) E280G possibly damaging Het
Phactr3 G A 2: 177,925,703 (GRCm39) R326H probably benign Het
Prob1 G A 18: 35,786,397 (GRCm39) P619L possibly damaging Het
Ptk2 G A 15: 73,167,224 (GRCm39) R368W probably damaging Het
Rgs6 A G 12: 83,116,293 (GRCm39) T240A probably benign Het
Rpa1 A T 11: 75,203,635 (GRCm39) Y356N probably damaging Het
Rxrb T A 17: 34,252,579 (GRCm39) D165E probably damaging Het
Sco1 A G 11: 66,944,628 (GRCm39) T84A possibly damaging Het
Sepsecs T C 5: 52,804,531 (GRCm39) I380V probably benign Het
Sfmbt1 T A 14: 30,538,759 (GRCm39) W793R probably damaging Het
Slco3a1 A G 7: 73,968,344 (GRCm39) S459P probably benign Het
Smg1 A T 7: 117,771,162 (GRCm39) S1503R possibly damaging Het
Sox2 G A 3: 34,704,791 (GRCm39) R76H probably damaging Het
Spty2d1 G A 7: 46,645,804 (GRCm39) S613F probably damaging Het
Stab2 A T 10: 86,793,776 (GRCm39) Y440N probably damaging Het
Syn3 A G 10: 85,916,117 (GRCm39) Y290H probably damaging Het
Tex15 C T 8: 34,071,875 (GRCm39) S2474F possibly damaging Het
Tgtp1 A G 11: 48,878,159 (GRCm39) F182S probably benign Het
Tmcc1 A T 6: 116,020,539 (GRCm39) S304R Het
Tmem130 T G 5: 144,680,580 (GRCm39) K275Q probably damaging Het
Tmem9 C A 1: 135,961,927 (GRCm39) T174K probably damaging Het
Ttyh3 C T 5: 140,620,538 (GRCm39) R233Q probably damaging Het
Tut7 A T 13: 59,963,389 (GRCm39) M323K possibly damaging Het
Twnk T C 19: 44,996,107 (GRCm39) M180T probably benign Het
Ube4a A G 9: 44,844,629 (GRCm39) V874A probably damaging Het
Ugt2a3 T C 5: 87,475,582 (GRCm39) N350S probably damaging Het
Vegfa C T 17: 46,342,761 (GRCm39) G19D probably damaging Het
Vmn2r2 C A 3: 64,041,518 (GRCm39) C399F possibly damaging Het
Vmn2r65 G T 7: 84,595,530 (GRCm39) P385T probably benign Het
Vmn2r65 A G 7: 84,596,192 (GRCm39) F164S probably damaging Het
Other mutations in Clca3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Clca3b APN 3 144,542,393 (GRCm39) missense probably damaging 0.96
IGL00425:Clca3b APN 3 144,542,342 (GRCm39) missense probably benign 0.14
IGL00725:Clca3b APN 3 144,544,923 (GRCm39) missense probably benign 0.01
IGL00898:Clca3b APN 3 144,550,389 (GRCm39) splice site probably benign
IGL00953:Clca3b APN 3 144,552,972 (GRCm39) nonsense probably null
IGL01089:Clca3b APN 3 144,529,283 (GRCm39) missense probably benign
IGL01376:Clca3b APN 3 144,531,812 (GRCm39) missense possibly damaging 0.60
IGL01996:Clca3b APN 3 144,554,924 (GRCm39) missense probably benign 0.04
IGL02022:Clca3b APN 3 144,547,171 (GRCm39) critical splice donor site probably null
IGL02200:Clca3b APN 3 144,547,190 (GRCm39) missense probably damaging 1.00
IGL02314:Clca3b APN 3 144,533,903 (GRCm39) splice site probably benign
IGL02331:Clca3b APN 3 144,547,167 (GRCm39) splice site probably benign
IGL02429:Clca3b APN 3 144,533,896 (GRCm39) missense probably damaging 1.00
IGL02868:Clca3b APN 3 144,533,325 (GRCm39) missense probably damaging 1.00
IGL03095:Clca3b APN 3 144,552,671 (GRCm39) nonsense probably null
IGL03331:Clca3b APN 3 144,533,724 (GRCm39) missense probably benign
R0242:Clca3b UTSW 3 144,547,226 (GRCm39) missense probably benign 0.00
R0242:Clca3b UTSW 3 144,547,226 (GRCm39) missense probably benign 0.00
R0506:Clca3b UTSW 3 144,528,627 (GRCm39) unclassified probably benign
R0524:Clca3b UTSW 3 144,531,082 (GRCm39) missense probably benign
R0637:Clca3b UTSW 3 144,533,701 (GRCm39) missense probably benign 0.03
R1577:Clca3b UTSW 3 144,529,280 (GRCm39) missense probably damaging 1.00
R1641:Clca3b UTSW 3 144,529,274 (GRCm39) missense possibly damaging 0.53
R1680:Clca3b UTSW 3 144,543,585 (GRCm39) missense probably damaging 1.00
R2240:Clca3b UTSW 3 144,531,696 (GRCm39) missense probably benign 0.22
R2248:Clca3b UTSW 3 144,530,980 (GRCm39) missense probably benign 0.01
R2259:Clca3b UTSW 3 144,552,142 (GRCm39) missense possibly damaging 0.80
R2920:Clca3b UTSW 3 144,552,692 (GRCm39) missense probably benign 0.01
R2920:Clca3b UTSW 3 144,543,614 (GRCm39) missense probably benign 0.31
R4355:Clca3b UTSW 3 144,531,219 (GRCm39) splice site probably null
R4691:Clca3b UTSW 3 144,544,853 (GRCm39) missense probably benign 0.02
R4828:Clca3b UTSW 3 144,550,273 (GRCm39) missense probably benign 0.02
R4845:Clca3b UTSW 3 144,531,031 (GRCm39) missense probably benign
R5182:Clca3b UTSW 3 144,533,776 (GRCm39) missense probably damaging 0.99
R5396:Clca3b UTSW 3 144,552,932 (GRCm39) missense probably damaging 0.99
R5429:Clca3b UTSW 3 144,552,220 (GRCm39) missense probably damaging 1.00
R5572:Clca3b UTSW 3 144,533,070 (GRCm39) missense probably damaging 1.00
R5657:Clca3b UTSW 3 144,533,144 (GRCm39) missense probably benign 0.25
R5845:Clca3b UTSW 3 144,531,077 (GRCm39) missense possibly damaging 0.46
R6505:Clca3b UTSW 3 144,531,020 (GRCm39) missense probably benign 0.18
R6677:Clca3b UTSW 3 144,529,145 (GRCm39) missense probably benign 0.13
R6707:Clca3b UTSW 3 144,550,288 (GRCm39) missense probably benign 0.00
R7001:Clca3b UTSW 3 144,533,733 (GRCm39) missense possibly damaging 0.48
R7285:Clca3b UTSW 3 144,543,519 (GRCm39) missense probably benign 0.00
R7323:Clca3b UTSW 3 144,531,681 (GRCm39) missense possibly damaging 0.60
R7324:Clca3b UTSW 3 144,547,181 (GRCm39) missense possibly damaging 0.81
R7334:Clca3b UTSW 3 144,542,417 (GRCm39) nonsense probably null
R7403:Clca3b UTSW 3 144,529,259 (GRCm39) missense probably benign 0.00
R8008:Clca3b UTSW 3 144,550,370 (GRCm39) missense probably benign 0.44
R8132:Clca3b UTSW 3 144,552,935 (GRCm39) missense probably benign 0.13
R8181:Clca3b UTSW 3 144,544,898 (GRCm39) missense probably benign 0.00
R8305:Clca3b UTSW 3 144,531,698 (GRCm39) missense probably damaging 1.00
R8546:Clca3b UTSW 3 144,533,158 (GRCm39) missense probably damaging 0.99
R8716:Clca3b UTSW 3 144,550,355 (GRCm39) missense probably benign 0.14
R8804:Clca3b UTSW 3 144,544,898 (GRCm39) missense probably benign 0.00
R8966:Clca3b UTSW 3 144,544,872 (GRCm39) missense probably benign 0.27
R9003:Clca3b UTSW 3 144,533,072 (GRCm39) nonsense probably null
R9455:Clca3b UTSW 3 144,529,023 (GRCm39) missense unknown
R9470:Clca3b UTSW 3 144,543,456 (GRCm39) missense probably damaging 1.00
R9658:Clca3b UTSW 3 144,543,575 (GRCm39) missense probably damaging 0.98
R9760:Clca3b UTSW 3 144,552,610 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTATCTTCCTGGAAATCGGAGG -3'
(R):5'- AACTCAAAATTACACTGAACTACCTT -3'

Sequencing Primer
(F):5'- CCTGGAAATCGGAGGTGGTG -3'
(R):5'- TTTCCAGAGTATTAAAGGCCAGACG -3'
Posted On 2019-11-26