Incidental Mutation 'R7798:Clca3b'
ID600341
Institutional Source Beutler Lab
Gene Symbol Clca3b
Ensembl Gene ENSMUSG00000037033
Gene Namechloride channel accessory 3B
SynonymsClca4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R7798 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location144822623-144849357 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 144828130 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 495 (S495G)
Ref Sequence ENSEMBL: ENSMUSP00000124581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159989]
Predicted Effect probably damaging
Transcript: ENSMUST00000159989
AA Change: S495G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124581
Gene: ENSMUSG00000037033
AA Change: S495G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 481 6.22e-19 SMART
FN3 762 861 4.93e0 SMART
low complexity region 880 1025 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700088E04Rik T A 15: 79,135,732 N128I probably damaging Het
5830473C10Rik T C 5: 90,597,511 S608P possibly damaging Het
Abca13 A G 11: 9,291,664 T1176A probably benign Het
Abca9 A G 11: 110,138,179 V851A probably benign Het
Abcc6 C A 7: 45,976,853 E1494* probably null Het
Adamts14 A T 10: 61,271,173 V56E probably damaging Het
Adamts15 G A 9: 30,904,643 T639M probably damaging Het
Arhgap11a A C 2: 113,843,335 V70G probably damaging Het
BC051665 A T 13: 60,784,435 D113E probably benign Het
Best1 T C 19: 9,991,671 Y227C probably damaging Het
Camk2b A G 11: 5,978,399 S447P probably benign Het
Ccdc88a C A 11: 29,477,348 Q1018K probably benign Het
Cfap74 T A 4: 155,422,622 V180D Het
Clca3a1 T A 3: 144,757,962 T185S probably damaging Het
Cyb5r2 A T 7: 107,753,948 Y96N possibly damaging Het
Cyp21a1 T C 17: 34,804,321 K27E probably benign Het
Cyp2ab1 T C 16: 20,312,416 E321G probably benign Het
Des T C 1: 75,362,359 I228T probably damaging Het
Dis3l G T 9: 64,341,017 P39T probably benign Het
Disp2 A C 2: 118,791,879 I1031L probably benign Het
Ell3 TCTCCTC TCTC 2: 121,439,456 probably benign Het
Etl4 G A 2: 20,781,946 probably null Het
Fgf23 A T 6: 127,073,214 D62V probably damaging Het
Galnt15 C T 14: 32,029,905 T138I possibly damaging Het
Ggt6 A T 11: 72,435,541 probably benign Het
Gm28710 T C 5: 16,856,658 F801L possibly damaging Het
Gm9573 C G 17: 35,621,254 G680A unknown Het
Gpr180 T A 14: 118,153,686 V209D probably damaging Het
Gzma A T 13: 113,096,324 F78Y probably benign Het
Igkv8-30 A T 6: 70,117,371 C19S probably benign Het
Il1r1 G A 1: 40,310,366 V361I probably benign Het
Intu T C 3: 40,691,929 V598A probably damaging Het
Itpr2 A G 6: 146,386,015 F471L probably benign Het
Kntc1 T A 5: 123,786,294 V1081E probably benign Het
Kntc1 T A 5: 123,819,117 V2163E possibly damaging Het
Macf1 T C 4: 123,378,100 K6552E probably damaging Het
Marf1 T C 16: 14,138,451 H842R probably benign Het
Mgat4b A G 11: 50,225,670 T10A possibly damaging Het
Muc5ac T C 7: 141,794,041 probably null Het
Nrk CGCAGCAGCAGCAGCAGCAGC CGCAGCAGCAGCAGCAGC X: 138,982,677 probably benign Het
Nsun4 T G 4: 116,051,174 S730R possibly damaging Het
Olfr1112 A T 2: 87,192,292 I202L probably benign Het
Olfr1310 A G 2: 112,008,272 F305L probably benign Het
Olfr351 T C 2: 36,860,336 E4G probably benign Het
Olfr360 A T 2: 37,069,174 S290C probably damaging Het
Olfr727 A T 14: 50,127,438 Y287F probably damaging Het
Padi3 C T 4: 140,786,439 E653K probably benign Het
Pde4a A G 9: 21,198,663 E280G possibly damaging Het
Phactr3 G A 2: 178,283,910 R326H probably benign Het
Prob1 G A 18: 35,653,344 P619L possibly damaging Het
Ptk2 G A 15: 73,295,375 R368W probably damaging Het
Rgs6 A G 12: 83,069,519 T240A probably benign Het
Rpa1 A T 11: 75,312,809 Y356N probably damaging Het
Rxrb T A 17: 34,033,605 D165E probably damaging Het
Sco1 A G 11: 67,053,802 T84A possibly damaging Het
Sepsecs T C 5: 52,647,189 I380V probably benign Het
Sfmbt1 T A 14: 30,816,802 W793R probably damaging Het
Slco3a1 A G 7: 74,318,596 S459P probably benign Het
Smg1 A T 7: 118,171,939 S1503R possibly damaging Het
Sox2 G A 3: 34,650,642 R76H probably damaging Het
Spty2d1 G A 7: 46,996,056 S613F probably damaging Het
Stab2 A T 10: 86,957,912 Y440N probably damaging Het
Syn3 A G 10: 86,080,253 Y290H probably damaging Het
Tex15 C T 8: 33,581,847 S2474F possibly damaging Het
Tgtp1 A G 11: 48,987,332 F182S probably benign Het
Tmcc1 A T 6: 116,043,578 S304R Het
Tmem130 T G 5: 144,743,770 K275Q probably damaging Het
Tmem9 C A 1: 136,034,189 T174K probably damaging Het
Ttyh3 C T 5: 140,634,783 R233Q probably damaging Het
Twnk T C 19: 45,007,668 M180T probably benign Het
Ube4a A G 9: 44,933,331 V874A probably damaging Het
Ugt2a3 T C 5: 87,327,723 N350S probably damaging Het
Vegfa C T 17: 46,031,835 G19D probably damaging Het
Vmn2r2 C A 3: 64,134,097 C399F possibly damaging Het
Vmn2r65 G T 7: 84,946,322 P385T probably benign Het
Vmn2r65 A G 7: 84,946,984 F164S probably damaging Het
Zcchc6 A T 13: 59,815,575 M323K possibly damaging Het
Other mutations in Clca3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Clca3b APN 3 144836632 missense probably damaging 0.96
IGL00425:Clca3b APN 3 144836581 missense probably benign 0.14
IGL00725:Clca3b APN 3 144839162 missense probably benign 0.01
IGL00898:Clca3b APN 3 144844628 splice site probably benign
IGL00953:Clca3b APN 3 144847211 nonsense probably null
IGL01089:Clca3b APN 3 144823522 missense probably benign
IGL01376:Clca3b APN 3 144826051 missense possibly damaging 0.60
IGL01996:Clca3b APN 3 144849163 missense probably benign 0.04
IGL02022:Clca3b APN 3 144841410 critical splice donor site probably null
IGL02200:Clca3b APN 3 144841429 missense probably damaging 1.00
IGL02314:Clca3b APN 3 144828142 splice site probably benign
IGL02331:Clca3b APN 3 144841406 splice site probably benign
IGL02429:Clca3b APN 3 144828135 missense probably damaging 1.00
IGL02868:Clca3b APN 3 144827564 missense probably damaging 1.00
IGL03095:Clca3b APN 3 144846910 nonsense probably null
IGL03331:Clca3b APN 3 144827963 missense probably benign
R0242:Clca3b UTSW 3 144841465 missense probably benign 0.00
R0242:Clca3b UTSW 3 144841465 missense probably benign 0.00
R0506:Clca3b UTSW 3 144822866 unclassified probably benign
R0524:Clca3b UTSW 3 144825321 missense probably benign
R0637:Clca3b UTSW 3 144827940 missense probably benign 0.03
R1577:Clca3b UTSW 3 144823519 missense probably damaging 1.00
R1641:Clca3b UTSW 3 144823513 missense possibly damaging 0.53
R1680:Clca3b UTSW 3 144837824 missense probably damaging 1.00
R2240:Clca3b UTSW 3 144825935 missense probably benign 0.22
R2248:Clca3b UTSW 3 144825219 missense probably benign 0.01
R2259:Clca3b UTSW 3 144846381 missense possibly damaging 0.80
R2920:Clca3b UTSW 3 144837853 missense probably benign 0.31
R2920:Clca3b UTSW 3 144846931 missense probably benign 0.01
R4355:Clca3b UTSW 3 144825458 splice site probably null
R4691:Clca3b UTSW 3 144839092 missense probably benign 0.02
R4828:Clca3b UTSW 3 144844512 missense probably benign 0.02
R4845:Clca3b UTSW 3 144825270 missense probably benign
R5182:Clca3b UTSW 3 144828015 missense probably damaging 0.99
R5396:Clca3b UTSW 3 144847171 missense probably damaging 0.99
R5429:Clca3b UTSW 3 144846459 missense probably damaging 1.00
R5572:Clca3b UTSW 3 144827309 missense probably damaging 1.00
R5657:Clca3b UTSW 3 144827383 missense probably benign 0.25
R5845:Clca3b UTSW 3 144825316 missense possibly damaging 0.46
R6505:Clca3b UTSW 3 144825259 missense probably benign 0.18
R6677:Clca3b UTSW 3 144823384 missense probably benign 0.13
R6707:Clca3b UTSW 3 144844527 missense probably benign 0.00
R7001:Clca3b UTSW 3 144827972 missense possibly damaging 0.48
R7285:Clca3b UTSW 3 144837758 missense probably benign 0.00
R7323:Clca3b UTSW 3 144825920 missense possibly damaging 0.60
R7324:Clca3b UTSW 3 144841420 missense possibly damaging 0.81
R7334:Clca3b UTSW 3 144836656 nonsense probably null
R7403:Clca3b UTSW 3 144823498 missense probably benign 0.00
R8008:Clca3b UTSW 3 144844609 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- TTATCTTCCTGGAAATCGGAGG -3'
(R):5'- AACTCAAAATTACACTGAACTACCTT -3'

Sequencing Primer
(F):5'- CCTGGAAATCGGAGGTGGTG -3'
(R):5'- TTTCCAGAGTATTAAAGGCCAGACG -3'
Posted On2019-11-26