Incidental Mutation 'R7798:Nsun4'
ID600342
Institutional Source Beutler Lab
Gene Symbol Nsun4
Ensembl Gene ENSMUSG00000028706
Gene NameNOL1/NOP2/Sun domain family, member 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.329) question?
Stock #R7798 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location116032842-116053876 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 116051174 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 730 (S730R)
Ref Sequence ENSEMBL: ENSMUSP00000130430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030474] [ENSMUST00000030475] [ENSMUST00000165493]
Predicted Effect probably benign
Transcript: ENSMUST00000030474
SMART Domains Protein: ENSMUSP00000030474
Gene: ENSMUSG00000028706

DomainStartEndE-ValueType
Pfam:Nol1_Nop2_Fmu 28 199 3.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000030475
SMART Domains Protein: ENSMUSP00000030475
Gene: ENSMUSG00000028706

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
Pfam:Nol1_Nop2_Fmu 163 356 9.7e-31 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000165493
AA Change: S730R

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000130430
Gene: ENSMUSG00000028706
AA Change: S730R

DomainStartEndE-ValueType
low complexity region 91 124 N/A INTRINSIC
low complexity region 277 290 N/A INTRINSIC
low complexity region 476 490 N/A INTRINSIC
low complexity region 553 565 N/A INTRINSIC
low complexity region 572 596 N/A INTRINSIC
low complexity region 677 700 N/A INTRINSIC
low complexity region 710 723 N/A INTRINSIC
low complexity region 733 756 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700088E04Rik T A 15: 79,135,732 N128I probably damaging Het
5830473C10Rik T C 5: 90,597,511 S608P possibly damaging Het
Abca13 A G 11: 9,291,664 T1176A probably benign Het
Abca9 A G 11: 110,138,179 V851A probably benign Het
Abcc6 C A 7: 45,976,853 E1494* probably null Het
Adamts14 A T 10: 61,271,173 V56E probably damaging Het
Adamts15 G A 9: 30,904,643 T639M probably damaging Het
Arhgap11a A C 2: 113,843,335 V70G probably damaging Het
BC051665 A T 13: 60,784,435 D113E probably benign Het
Best1 T C 19: 9,991,671 Y227C probably damaging Het
Camk2b A G 11: 5,978,399 S447P probably benign Het
Ccdc88a C A 11: 29,477,348 Q1018K probably benign Het
Cfap74 T A 4: 155,422,622 V180D Het
Clca3a1 T A 3: 144,757,962 T185S probably damaging Het
Clca3b T C 3: 144,828,130 S495G probably damaging Het
Cyb5r2 A T 7: 107,753,948 Y96N possibly damaging Het
Cyp21a1 T C 17: 34,804,321 K27E probably benign Het
Cyp2ab1 T C 16: 20,312,416 E321G probably benign Het
Des T C 1: 75,362,359 I228T probably damaging Het
Dis3l G T 9: 64,341,017 P39T probably benign Het
Disp2 A C 2: 118,791,879 I1031L probably benign Het
Ell3 TCTCCTC TCTC 2: 121,439,456 probably benign Het
Etl4 G A 2: 20,781,946 probably null Het
Fgf23 A T 6: 127,073,214 D62V probably damaging Het
Galnt15 C T 14: 32,029,905 T138I possibly damaging Het
Ggt6 A T 11: 72,435,541 probably benign Het
Gm28710 T C 5: 16,856,658 F801L possibly damaging Het
Gm9573 C G 17: 35,621,254 G680A unknown Het
Gpr180 T A 14: 118,153,686 V209D probably damaging Het
Gzma A T 13: 113,096,324 F78Y probably benign Het
Igkv8-30 A T 6: 70,117,371 C19S probably benign Het
Il1r1 G A 1: 40,310,366 V361I probably benign Het
Intu T C 3: 40,691,929 V598A probably damaging Het
Itpr2 A G 6: 146,386,015 F471L probably benign Het
Kntc1 T A 5: 123,786,294 V1081E probably benign Het
Kntc1 T A 5: 123,819,117 V2163E possibly damaging Het
Macf1 T C 4: 123,378,100 K6552E probably damaging Het
Marf1 T C 16: 14,138,451 H842R probably benign Het
Mgat4b A G 11: 50,225,670 T10A possibly damaging Het
Muc5ac T C 7: 141,794,041 probably null Het
Nrk CGCAGCAGCAGCAGCAGCAGC CGCAGCAGCAGCAGCAGC X: 138,982,677 probably benign Het
Olfr1112 A T 2: 87,192,292 I202L probably benign Het
Olfr1310 A G 2: 112,008,272 F305L probably benign Het
Olfr351 T C 2: 36,860,336 E4G probably benign Het
Olfr360 A T 2: 37,069,174 S290C probably damaging Het
Olfr727 A T 14: 50,127,438 Y287F probably damaging Het
Padi3 C T 4: 140,786,439 E653K probably benign Het
Pde4a A G 9: 21,198,663 E280G possibly damaging Het
Phactr3 G A 2: 178,283,910 R326H probably benign Het
Prob1 G A 18: 35,653,344 P619L possibly damaging Het
Ptk2 G A 15: 73,295,375 R368W probably damaging Het
Rgs6 A G 12: 83,069,519 T240A probably benign Het
Rpa1 A T 11: 75,312,809 Y356N probably damaging Het
Rxrb T A 17: 34,033,605 D165E probably damaging Het
Sco1 A G 11: 67,053,802 T84A possibly damaging Het
Sepsecs T C 5: 52,647,189 I380V probably benign Het
Sfmbt1 T A 14: 30,816,802 W793R probably damaging Het
Slco3a1 A G 7: 74,318,596 S459P probably benign Het
Smg1 A T 7: 118,171,939 S1503R possibly damaging Het
Sox2 G A 3: 34,650,642 R76H probably damaging Het
Spty2d1 G A 7: 46,996,056 S613F probably damaging Het
Stab2 A T 10: 86,957,912 Y440N probably damaging Het
Syn3 A G 10: 86,080,253 Y290H probably damaging Het
Tex15 C T 8: 33,581,847 S2474F possibly damaging Het
Tgtp1 A G 11: 48,987,332 F182S probably benign Het
Tmcc1 A T 6: 116,043,578 S304R Het
Tmem130 T G 5: 144,743,770 K275Q probably damaging Het
Tmem9 C A 1: 136,034,189 T174K probably damaging Het
Ttyh3 C T 5: 140,634,783 R233Q probably damaging Het
Twnk T C 19: 45,007,668 M180T probably benign Het
Ube4a A G 9: 44,933,331 V874A probably damaging Het
Ugt2a3 T C 5: 87,327,723 N350S probably damaging Het
Vegfa C T 17: 46,031,835 G19D probably damaging Het
Vmn2r2 C A 3: 64,134,097 C399F possibly damaging Het
Vmn2r65 G T 7: 84,946,322 P385T probably benign Het
Vmn2r65 A G 7: 84,946,984 F164S probably damaging Het
Zcchc6 A T 13: 59,815,575 M323K possibly damaging Het
Other mutations in Nsun4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0089:Nsun4 UTSW 4 116035773 missense probably benign 0.01
R0306:Nsun4 UTSW 4 116052822 nonsense probably null
R0365:Nsun4 UTSW 4 116044738 missense probably damaging 1.00
R1440:Nsun4 UTSW 4 116052950 missense possibly damaging 0.83
R1624:Nsun4 UTSW 4 116034200 missense probably benign 0.05
R2058:Nsun4 UTSW 4 116053680 splice site probably null
R2262:Nsun4 UTSW 4 116052950 missense probably benign 0.27
R2438:Nsun4 UTSW 4 116048597 missense probably benign 0.01
R3029:Nsun4 UTSW 4 116052725 missense possibly damaging 0.83
R4012:Nsun4 UTSW 4 116051062 missense possibly damaging 0.66
R4162:Nsun4 UTSW 4 116034194 nonsense probably null
R4166:Nsun4 UTSW 4 116034051 missense probably damaging 0.98
R4277:Nsun4 UTSW 4 116034282 missense probably damaging 1.00
R4433:Nsun4 UTSW 4 116040130 missense possibly damaging 0.75
R4450:Nsun4 UTSW 4 116051256 nonsense probably null
R5077:Nsun4 UTSW 4 116048584 missense probably benign 0.00
R5307:Nsun4 UTSW 4 116034138 missense probably damaging 0.98
R5509:Nsun4 UTSW 4 116051777 missense possibly damaging 0.46
R5510:Nsun4 UTSW 4 116051777 missense possibly damaging 0.46
R6145:Nsun4 UTSW 4 116040206 missense probably damaging 1.00
R6520:Nsun4 UTSW 4 116044738 missense probably damaging 1.00
R6848:Nsun4 UTSW 4 116052934 missense possibly damaging 0.90
R7346:Nsun4 UTSW 4 116051838 missense probably benign 0.01
R7528:Nsun4 UTSW 4 116034194 nonsense probably null
R7560:Nsun4 UTSW 4 116051494 missense possibly damaging 0.92
R7719:Nsun4 UTSW 4 116052420 missense possibly damaging 0.82
R7868:Nsun4 UTSW 4 116034132 missense probably benign
R7951:Nsun4 UTSW 4 116034132 missense probably benign
R8074:Nsun4 UTSW 4 116051434 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CCTATGCTGGAGACTCTTGCTC -3'
(R):5'- ACCTATGCTGTGACTTCTCCAG -3'

Sequencing Primer
(F):5'- GGAGACTCTTGCTCTGGCTTTC -3'
(R):5'- GTCCCACTGAACAATCCCTC -3'
Posted On2019-11-26