Incidental Mutation 'R7798:Itpr2'
ID600357
Institutional Source Beutler Lab
Gene Symbol Itpr2
Ensembl Gene ENSMUSG00000030287
Gene Nameinositol 1,4,5-triphosphate receptor 2
SynonymsItpr5, Ip3r2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7798 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location146108299-146502223 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 146386015 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 471 (F471L)
Ref Sequence ENSEMBL: ENSMUSP00000049584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053273] [ENSMUST00000079573] [ENSMUST00000131890] [ENSMUST00000139732]
Predicted Effect probably benign
Transcript: ENSMUST00000053273
AA Change: F471L

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000049584
Gene: ENSMUSG00000030287
AA Change: F471L

DomainStartEndE-ValueType
low complexity region 68 80 N/A INTRINSIC
MIR 112 166 1.1e-5 SMART
MIR 173 223 8.9e-6 SMART
MIR 231 287 5.11e-6 SMART
MIR 294 402 3.73e-8 SMART
Pfam:RYDR_ITPR 473 670 1.5e-62 PFAM
low complexity region 882 890 N/A INTRINSIC
Pfam:RYDR_ITPR 1183 1346 1.6e-16 PFAM
low complexity region 1773 1785 N/A INTRINSIC
low complexity region 1897 1908 N/A INTRINSIC
Pfam:RIH_assoc 1912 2022 4.6e-34 PFAM
low complexity region 2088 2098 N/A INTRINSIC
transmembrane domain 2228 2250 N/A INTRINSIC
Pfam:Ion_trans 2260 2552 5.1e-20 PFAM
coiled coil region 2631 2686 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000079573
AA Change: F438L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000078526
Gene: ENSMUSG00000030287
AA Change: F438L

DomainStartEndE-ValueType
low complexity region 68 80 N/A INTRINSIC
MIR 112 166 1.1e-5 SMART
MIR 198 254 5.11e-6 SMART
MIR 261 369 3.73e-8 SMART
Pfam:RYDR_ITPR 438 644 5.4e-75 PFAM
low complexity region 849 857 N/A INTRINSIC
Pfam:RYDR_ITPR 1148 1322 7.2e-60 PFAM
low complexity region 1740 1752 N/A INTRINSIC
Pfam:RIH_assoc 1875 1994 5.8e-35 PFAM
low complexity region 2055 2065 N/A INTRINSIC
transmembrane domain 2195 2217 N/A INTRINSIC
transmembrane domain 2230 2249 N/A INTRINSIC
low complexity region 2268 2279 N/A INTRINSIC
Pfam:Ion_trans 2281 2507 2.4e-12 PFAM
coiled coil region 2598 2653 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131890
AA Change: F113L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000121773
Gene: ENSMUSG00000030287
AA Change: F113L

DomainStartEndE-ValueType
Pfam:MIR 1 74 4.8e-22 PFAM
Pfam:RYDR_ITPR 113 319 1.9e-76 PFAM
low complexity region 524 532 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139732
SMART Domains Protein: ENSMUSP00000119110
Gene: ENSMUSG00000030287

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
MIR 65 119 1.1e-5 SMART
MIR 126 176 8.9e-6 SMART
MIR 184 240 5.11e-6 SMART
MIR 247 355 3.73e-8 SMART
Pfam:RYDR_ITPR 424 630 3e-76 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the inositol 1,4,5-triphosphate receptor family, whose members are second messenger intracellular calcium release channels. These proteins mediate a rise in cytoplasmic calcium in response to receptor activated production of inositol triphosphate. Inositol triphosphate receptor-mediated signaling is involved in many processes including cell migration, cell division, smooth muscle contraction, and neuronal signaling. This protein is a type 2 receptor that consists of a cytoplasmic amino-terminus that binds inositol triphosphate, six membrane-spanning helices that contribute to the ion pore, and a short cytoplasmic carboxy-terminus. A mutation in this gene has been associated with anhidrosis, suggesting that intracellular calcium release mediated by this protein is required for eccrine sweat production. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for a knock-out allele are viable and fertile but show decreased sweating and disturbed calcium signaling in sweat glands. Mice homozygous for a different knock-out allele have atrial myocytes that are significantly less prone to develop proarrhythmic disturbances in calcium signaling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700088E04Rik T A 15: 79,135,732 N128I probably damaging Het
5830473C10Rik T C 5: 90,597,511 S608P possibly damaging Het
Abca13 A G 11: 9,291,664 T1176A probably benign Het
Abca9 A G 11: 110,138,179 V851A probably benign Het
Abcc6 C A 7: 45,976,853 E1494* probably null Het
Adamts14 A T 10: 61,271,173 V56E probably damaging Het
Adamts15 G A 9: 30,904,643 T639M probably damaging Het
Arhgap11a A C 2: 113,843,335 V70G probably damaging Het
BC051665 A T 13: 60,784,435 D113E probably benign Het
Best1 T C 19: 9,991,671 Y227C probably damaging Het
Camk2b A G 11: 5,978,399 S447P probably benign Het
Ccdc88a C A 11: 29,477,348 Q1018K probably benign Het
Cfap74 T A 4: 155,422,622 V180D Het
Clca3a1 T A 3: 144,757,962 T185S probably damaging Het
Clca3b T C 3: 144,828,130 S495G probably damaging Het
Cyb5r2 A T 7: 107,753,948 Y96N possibly damaging Het
Cyp21a1 T C 17: 34,804,321 K27E probably benign Het
Cyp2ab1 T C 16: 20,312,416 E321G probably benign Het
Des T C 1: 75,362,359 I228T probably damaging Het
Dis3l G T 9: 64,341,017 P39T probably benign Het
Disp2 A C 2: 118,791,879 I1031L probably benign Het
Ell3 TCTCCTC TCTC 2: 121,439,456 probably benign Het
Etl4 G A 2: 20,781,946 probably null Het
Fgf23 A T 6: 127,073,214 D62V probably damaging Het
Galnt15 C T 14: 32,029,905 T138I possibly damaging Het
Ggt6 A T 11: 72,435,541 probably benign Het
Gm28710 T C 5: 16,856,658 F801L possibly damaging Het
Gm9573 C G 17: 35,621,254 G680A unknown Het
Gpr180 T A 14: 118,153,686 V209D probably damaging Het
Gzma A T 13: 113,096,324 F78Y probably benign Het
Igkv8-30 A T 6: 70,117,371 C19S probably benign Het
Il1r1 G A 1: 40,310,366 V361I probably benign Het
Intu T C 3: 40,691,929 V598A probably damaging Het
Kntc1 T A 5: 123,786,294 V1081E probably benign Het
Kntc1 T A 5: 123,819,117 V2163E possibly damaging Het
Macf1 T C 4: 123,378,100 K6552E probably damaging Het
Marf1 T C 16: 14,138,451 H842R probably benign Het
Mgat4b A G 11: 50,225,670 T10A possibly damaging Het
Muc5ac T C 7: 141,794,041 probably null Het
Nrk CGCAGCAGCAGCAGCAGCAGC CGCAGCAGCAGCAGCAGC X: 138,982,677 probably benign Het
Nsun4 T G 4: 116,051,174 S730R possibly damaging Het
Olfr1112 A T 2: 87,192,292 I202L probably benign Het
Olfr1310 A G 2: 112,008,272 F305L probably benign Het
Olfr351 T C 2: 36,860,336 E4G probably benign Het
Olfr360 A T 2: 37,069,174 S290C probably damaging Het
Olfr727 A T 14: 50,127,438 Y287F probably damaging Het
Padi3 C T 4: 140,786,439 E653K probably benign Het
Pde4a A G 9: 21,198,663 E280G possibly damaging Het
Phactr3 G A 2: 178,283,910 R326H probably benign Het
Prob1 G A 18: 35,653,344 P619L possibly damaging Het
Ptk2 G A 15: 73,295,375 R368W probably damaging Het
Rgs6 A G 12: 83,069,519 T240A probably benign Het
Rpa1 A T 11: 75,312,809 Y356N probably damaging Het
Rxrb T A 17: 34,033,605 D165E probably damaging Het
Sco1 A G 11: 67,053,802 T84A possibly damaging Het
Sepsecs T C 5: 52,647,189 I380V probably benign Het
Sfmbt1 T A 14: 30,816,802 W793R probably damaging Het
Slco3a1 A G 7: 74,318,596 S459P probably benign Het
Smg1 A T 7: 118,171,939 S1503R possibly damaging Het
Sox2 G A 3: 34,650,642 R76H probably damaging Het
Spty2d1 G A 7: 46,996,056 S613F probably damaging Het
Stab2 A T 10: 86,957,912 Y440N probably damaging Het
Syn3 A G 10: 86,080,253 Y290H probably damaging Het
Tex15 C T 8: 33,581,847 S2474F possibly damaging Het
Tgtp1 A G 11: 48,987,332 F182S probably benign Het
Tmcc1 A T 6: 116,043,578 S304R Het
Tmem130 T G 5: 144,743,770 K275Q probably damaging Het
Tmem9 C A 1: 136,034,189 T174K probably damaging Het
Ttyh3 C T 5: 140,634,783 R233Q probably damaging Het
Twnk T C 19: 45,007,668 M180T probably benign Het
Ube4a A G 9: 44,933,331 V874A probably damaging Het
Ugt2a3 T C 5: 87,327,723 N350S probably damaging Het
Vegfa C T 17: 46,031,835 G19D probably damaging Het
Vmn2r2 C A 3: 64,134,097 C399F possibly damaging Het
Vmn2r65 G T 7: 84,946,322 P385T probably benign Het
Vmn2r65 A G 7: 84,946,984 F164S probably damaging Het
Zcchc6 A T 13: 59,815,575 M323K possibly damaging Het
Other mutations in Itpr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Itpr2 APN 6 146397012 missense probably damaging 0.99
IGL00163:Itpr2 APN 6 146390836 missense possibly damaging 0.88
IGL00229:Itpr2 APN 6 146144185 missense probably damaging 1.00
IGL00712:Itpr2 APN 6 146232436 missense possibly damaging 0.63
IGL00952:Itpr2 APN 6 146158961 missense probably damaging 1.00
IGL00983:Itpr2 APN 6 146310981 splice site probably benign
IGL01012:Itpr2 APN 6 146345161 missense probably damaging 1.00
IGL01289:Itpr2 APN 6 146112535 nonsense probably null
IGL01411:Itpr2 APN 6 146376062 critical splice donor site probably null
IGL01557:Itpr2 APN 6 146158976 missense probably damaging 0.99
IGL01669:Itpr2 APN 6 146180229 missense probably damaging 1.00
IGL01809:Itpr2 APN 6 146227581 missense probably damaging 1.00
IGL01814:Itpr2 APN 6 146232546 missense probably benign 0.02
IGL02198:Itpr2 APN 6 146323227 missense probably damaging 1.00
IGL02218:Itpr2 APN 6 146240262 splice site probably benign
IGL02332:Itpr2 APN 6 146426542 missense probably damaging 1.00
IGL02425:Itpr2 APN 6 146391321 missense probably damaging 0.99
IGL02432:Itpr2 APN 6 146325173 missense probably benign 0.05
IGL02726:Itpr2 APN 6 146375921 missense probably benign 0.18
IGL02851:Itpr2 APN 6 146385979 missense probably damaging 0.99
IGL02933:Itpr2 APN 6 146312904 missense probably benign
IGL03015:Itpr2 APN 6 146375937 missense probably benign
IGL03067:Itpr2 APN 6 146325182 missense probably damaging 1.00
IGL03093:Itpr2 APN 6 146379510 missense probably damaging 1.00
IGL03214:Itpr2 APN 6 146180244 missense probably benign 0.02
IGL03275:Itpr2 APN 6 146158877 splice site probably benign
IGL03332:Itpr2 APN 6 146144149 missense probably damaging 0.98
IGL03352:Itpr2 APN 6 146157104 missense probably damaging 1.00
IGL03377:Itpr2 APN 6 146329715 missense probably damaging 0.96
IGL03377:Itpr2 APN 6 146329758 missense probably benign
dollar_short UTSW 6 146397019 nonsense probably null
enfermos UTSW 6 146234006 missense probably damaging 0.98
P0029:Itpr2 UTSW 6 146379489 missense probably damaging 1.00
PIT4431001:Itpr2 UTSW 6 146354720 missense probably benign
PIT4453001:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
PIT4504001:Itpr2 UTSW 6 146229871 missense probably damaging 0.99
R0040:Itpr2 UTSW 6 146345140 missense probably damaging 1.00
R0040:Itpr2 UTSW 6 146345140 missense probably damaging 1.00
R0048:Itpr2 UTSW 6 146232291 splice site probably null
R0048:Itpr2 UTSW 6 146232291 splice site probably null
R0055:Itpr2 UTSW 6 146323133 missense probably benign 0.42
R0055:Itpr2 UTSW 6 146323133 missense probably benign 0.42
R0088:Itpr2 UTSW 6 146241185 missense probably benign
R0089:Itpr2 UTSW 6 146350022 critical splice donor site probably null
R0114:Itpr2 UTSW 6 146312879 missense probably damaging 1.00
R0125:Itpr2 UTSW 6 146240453 missense probably benign 0.00
R0144:Itpr2 UTSW 6 146327155 missense probably damaging 0.98
R0180:Itpr2 UTSW 6 146501909 start gained probably benign
R0211:Itpr2 UTSW 6 146194613 missense probably benign 0.17
R0305:Itpr2 UTSW 6 146311103 missense possibly damaging 0.63
R0367:Itpr2 UTSW 6 146234008 missense probably damaging 1.00
R0374:Itpr2 UTSW 6 146359392 missense probably benign 0.00
R0391:Itpr2 UTSW 6 146229773 missense probably damaging 1.00
R0450:Itpr2 UTSW 6 146417979 missense possibly damaging 0.66
R0464:Itpr2 UTSW 6 146375889 missense probably damaging 1.00
R0510:Itpr2 UTSW 6 146417979 missense possibly damaging 0.66
R0532:Itpr2 UTSW 6 146112400 missense probably damaging 1.00
R0625:Itpr2 UTSW 6 146166651 missense probably benign
R0633:Itpr2 UTSW 6 146374456 missense probably damaging 1.00
R0636:Itpr2 UTSW 6 146171412 missense probably damaging 1.00
R1086:Itpr2 UTSW 6 146350045 missense probably damaging 1.00
R1352:Itpr2 UTSW 6 146111742 missense probably damaging 1.00
R1631:Itpr2 UTSW 6 146180290 missense probably damaging 1.00
R1655:Itpr2 UTSW 6 146376148 missense probably damaging 1.00
R1767:Itpr2 UTSW 6 146350068 missense possibly damaging 0.91
R1779:Itpr2 UTSW 6 146158901 nonsense probably null
R1796:Itpr2 UTSW 6 146296673 missense probably benign
R1815:Itpr2 UTSW 6 146359416 missense probably benign 0.08
R1827:Itpr2 UTSW 6 146328332 missense probably damaging 1.00
R1828:Itpr2 UTSW 6 146328332 missense probably damaging 1.00
R1884:Itpr2 UTSW 6 146385971 missense probably benign 0.16
R1902:Itpr2 UTSW 6 146229703 missense probably damaging 1.00
R1931:Itpr2 UTSW 6 146240354 missense probably benign 0.41
R1964:Itpr2 UTSW 6 146111693 missense probably damaging 1.00
R2010:Itpr2 UTSW 6 146227524 synonymous probably null
R2168:Itpr2 UTSW 6 146111678 missense probably benign 0.05
R2179:Itpr2 UTSW 6 146375966 missense probably benign
R2290:Itpr2 UTSW 6 146422828 missense probably damaging 1.00
R2874:Itpr2 UTSW 6 146426498 missense possibly damaging 0.73
R2888:Itpr2 UTSW 6 146171293 missense probably damaging 1.00
R2897:Itpr2 UTSW 6 146173341 missense probably benign 0.03
R2897:Itpr2 UTSW 6 146323169 missense probably damaging 1.00
R2898:Itpr2 UTSW 6 146173341 missense probably benign 0.03
R2898:Itpr2 UTSW 6 146323169 missense probably damaging 1.00
R3024:Itpr2 UTSW 6 146180310 missense probably benign 0.35
R3104:Itpr2 UTSW 6 146312837 critical splice donor site probably null
R3607:Itpr2 UTSW 6 146227601 missense probably damaging 0.98
R3732:Itpr2 UTSW 6 146382700 missense probably damaging 1.00
R3732:Itpr2 UTSW 6 146382700 missense probably damaging 1.00
R3733:Itpr2 UTSW 6 146382700 missense probably damaging 1.00
R3792:Itpr2 UTSW 6 146415354 missense probably damaging 1.00
R3806:Itpr2 UTSW 6 146232291 splice site probably null
R3821:Itpr2 UTSW 6 146417726 missense probably damaging 1.00
R3929:Itpr2 UTSW 6 146374359 splice site probably null
R3958:Itpr2 UTSW 6 146425510 missense probably damaging 0.97
R3959:Itpr2 UTSW 6 146425510 missense probably damaging 0.97
R3960:Itpr2 UTSW 6 146229764 missense probably damaging 1.00
R3960:Itpr2 UTSW 6 146425510 missense probably damaging 0.97
R4074:Itpr2 UTSW 6 146373244 splice site probably null
R4085:Itpr2 UTSW 6 146144248 missense probably damaging 1.00
R4114:Itpr2 UTSW 6 146425510 missense probably damaging 0.97
R4115:Itpr2 UTSW 6 146425510 missense probably damaging 0.97
R4588:Itpr2 UTSW 6 146241196 missense probably benign 0.33
R4663:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4673:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4684:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4686:Itpr2 UTSW 6 146229775 missense probably damaging 1.00
R4713:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4713:Itpr2 UTSW 6 146396958 missense probably damaging 1.00
R4729:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4732:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4733:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4801:Itpr2 UTSW 6 146371331 missense probably damaging 1.00
R4802:Itpr2 UTSW 6 146371331 missense probably damaging 1.00
R4877:Itpr2 UTSW 6 146325205 missense probably damaging 1.00
R4970:Itpr2 UTSW 6 146233991 missense possibly damaging 0.95
R4986:Itpr2 UTSW 6 146240342 missense probably damaging 0.96
R5112:Itpr2 UTSW 6 146233991 missense possibly damaging 0.95
R5200:Itpr2 UTSW 6 146144107 critical splice donor site probably null
R5224:Itpr2 UTSW 6 146166651 missense probably benign
R5243:Itpr2 UTSW 6 146187546 missense probably damaging 1.00
R5348:Itpr2 UTSW 6 146476693 missense possibly damaging 0.78
R5393:Itpr2 UTSW 6 146376155 nonsense probably null
R5552:Itpr2 UTSW 6 146294080 missense probably benign
R5579:Itpr2 UTSW 6 146173366 nonsense probably null
R5744:Itpr2 UTSW 6 146376151 missense probably damaging 1.00
R5825:Itpr2 UTSW 6 146144149 missense probably damaging 0.98
R5910:Itpr2 UTSW 6 146329571 missense probably benign 0.10
R5911:Itpr2 UTSW 6 146312943 missense probably benign 0.42
R6044:Itpr2 UTSW 6 146396951 missense probably null 0.98
R6072:Itpr2 UTSW 6 146347111 missense probably damaging 0.98
R6191:Itpr2 UTSW 6 146328335 missense probably benign 0.01
R6483:Itpr2 UTSW 6 146112477 missense possibly damaging 0.52
R6511:Itpr2 UTSW 6 146329727 missense probably damaging 1.00
R6524:Itpr2 UTSW 6 146345211 missense probably benign 0.01
R6561:Itpr2 UTSW 6 146234006 missense probably damaging 0.98
R6594:Itpr2 UTSW 6 146190480 missense possibly damaging 0.71
R6603:Itpr2 UTSW 6 146347171 missense probably damaging 0.98
R6736:Itpr2 UTSW 6 146325170 missense probably damaging 1.00
R6783:Itpr2 UTSW 6 146385873 critical splice donor site probably null
R6831:Itpr2 UTSW 6 146112429 missense probably damaging 1.00
R6857:Itpr2 UTSW 6 146397019 nonsense probably null
R7103:Itpr2 UTSW 6 146325074 missense probably damaging 1.00
R7111:Itpr2 UTSW 6 146325056 missense probably damaging 1.00
R7126:Itpr2 UTSW 6 146357796 nonsense probably null
R7165:Itpr2 UTSW 6 146294091 missense probably damaging 1.00
R7184:Itpr2 UTSW 6 146311087 missense possibly damaging 0.79
R7249:Itpr2 UTSW 6 146311052 missense probably damaging 1.00
R7292:Itpr2 UTSW 6 146158949 missense possibly damaging 0.95
R7342:Itpr2 UTSW 6 146327187 missense probably damaging 0.98
R7392:Itpr2 UTSW 6 146359340 missense possibly damaging 0.95
R7414:Itpr2 UTSW 6 146373208 missense probably benign 0.06
R7448:Itpr2 UTSW 6 146329508 missense probably damaging 1.00
R7492:Itpr2 UTSW 6 146390938 missense probably damaging 1.00
R7515:Itpr2 UTSW 6 146327110 missense probably damaging 1.00
R7529:Itpr2 UTSW 6 146194598 missense probably damaging 0.98
R7558:Itpr2 UTSW 6 146390865 missense probably damaging 1.00
R7650:Itpr2 UTSW 6 146233994 missense probably benign 0.36
R7678:Itpr2 UTSW 6 146187550 missense probably benign 0.00
R7790:Itpr2 UTSW 6 146224776 missense probably damaging 1.00
R7831:Itpr2 UTSW 6 146291584 missense probably benign 0.04
R7914:Itpr2 UTSW 6 146291584 missense probably benign 0.04
R8023:Itpr2 UTSW 6 146187490 missense probably damaging 0.97
R8046:Itpr2 UTSW 6 146426459 missense probably damaging 0.96
V8831:Itpr2 UTSW 6 146385882 missense probably damaging 1.00
X0054:Itpr2 UTSW 6 146323236 missense probably damaging 1.00
X0063:Itpr2 UTSW 6 146180353 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGCAAGGCATGACTGATAC -3'
(R):5'- GTGGTGGGAAATACTGTGAAAGTTC -3'

Sequencing Primer
(F):5'- AAGAGTTCACCGATGCTGC -3'
(R):5'- TACTGTGAAAGTTCAGGCAAGTAGC -3'
Posted On2019-11-26