Incidental Mutation 'R7798:Tex15'
ID600366
Institutional Source Beutler Lab
Gene Symbol Tex15
Ensembl Gene ENSMUSG00000009628
Gene Nametestis expressed gene 15
Synonyms2210014E14Rik
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_031374.2; MGI: 1934816

Is this an essential gene? Possibly non essential (E-score: 0.442) question?
Stock #R7798 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location33516738-33585582 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 33581847 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 2474 (S2474F)
Ref Sequence ENSEMBL: ENSMUSP00000009772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009772] [ENSMUST00000124501]
Predicted Effect possibly damaging
Transcript: ENSMUST00000009772
AA Change: S2474F

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000009772
Gene: ENSMUSG00000009628
AA Change: S2474F

DomainStartEndE-ValueType
low complexity region 262 274 N/A INTRINSIC
low complexity region 302 313 N/A INTRINSIC
low complexity region 524 536 N/A INTRINSIC
low complexity region 665 674 N/A INTRINSIC
low complexity region 713 725 N/A INTRINSIC
low complexity region 946 961 N/A INTRINSIC
low complexity region 1497 1508 N/A INTRINSIC
Pfam:TEX15 1572 1788 1.3e-109 PFAM
Pfam:TEX15 1901 2119 1.1e-16 PFAM
low complexity region 2758 2770 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124501
SMART Domains Protein: ENSMUSP00000138070
Gene: ENSMUSG00000009628

DomainStartEndE-ValueType
Pfam:DUF3715 96 251 2.4e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype Strain: 3526165
PHENOTYPE: Male mice are infertile due to arrest of meiosis stemming from failure to repair double-strand breaks. However, female mice are fertile. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700088E04Rik T A 15: 79,135,732 N128I probably damaging Het
5830473C10Rik T C 5: 90,597,511 S608P possibly damaging Het
Abca13 A G 11: 9,291,664 T1176A probably benign Het
Abca9 A G 11: 110,138,179 V851A probably benign Het
Abcc6 C A 7: 45,976,853 E1494* probably null Het
Adamts14 A T 10: 61,271,173 V56E probably damaging Het
Adamts15 G A 9: 30,904,643 T639M probably damaging Het
Arhgap11a A C 2: 113,843,335 V70G probably damaging Het
BC051665 A T 13: 60,784,435 D113E probably benign Het
Best1 T C 19: 9,991,671 Y227C probably damaging Het
Camk2b A G 11: 5,978,399 S447P probably benign Het
Ccdc88a C A 11: 29,477,348 Q1018K probably benign Het
Cfap74 T A 4: 155,422,622 V180D Het
Clca3a1 T A 3: 144,757,962 T185S probably damaging Het
Clca3b T C 3: 144,828,130 S495G probably damaging Het
Cyb5r2 A T 7: 107,753,948 Y96N possibly damaging Het
Cyp21a1 T C 17: 34,804,321 K27E probably benign Het
Cyp2ab1 T C 16: 20,312,416 E321G probably benign Het
Des T C 1: 75,362,359 I228T probably damaging Het
Dis3l G T 9: 64,341,017 P39T probably benign Het
Disp2 A C 2: 118,791,879 I1031L probably benign Het
Ell3 TCTCCTC TCTC 2: 121,439,456 probably benign Het
Etl4 G A 2: 20,781,946 probably null Het
Fgf23 A T 6: 127,073,214 D62V probably damaging Het
Galnt15 C T 14: 32,029,905 T138I possibly damaging Het
Ggt6 A T 11: 72,435,541 probably benign Het
Gm28710 T C 5: 16,856,658 F801L possibly damaging Het
Gm9573 C G 17: 35,621,254 G680A unknown Het
Gpr180 T A 14: 118,153,686 V209D probably damaging Het
Gzma A T 13: 113,096,324 F78Y probably benign Het
Igkv8-30 A T 6: 70,117,371 C19S probably benign Het
Il1r1 G A 1: 40,310,366 V361I probably benign Het
Intu T C 3: 40,691,929 V598A probably damaging Het
Itpr2 A G 6: 146,386,015 F471L probably benign Het
Kntc1 T A 5: 123,786,294 V1081E probably benign Het
Kntc1 T A 5: 123,819,117 V2163E possibly damaging Het
Macf1 T C 4: 123,378,100 K6552E probably damaging Het
Marf1 T C 16: 14,138,451 H842R probably benign Het
Mgat4b A G 11: 50,225,670 T10A possibly damaging Het
Muc5ac T C 7: 141,794,041 probably null Het
Nrk CGCAGCAGCAGCAGCAGCAGC CGCAGCAGCAGCAGCAGC X: 138,982,677 probably benign Het
Nsun4 T G 4: 116,051,174 S730R possibly damaging Het
Olfr1112 A T 2: 87,192,292 I202L probably benign Het
Olfr1310 A G 2: 112,008,272 F305L probably benign Het
Olfr351 T C 2: 36,860,336 E4G probably benign Het
Olfr360 A T 2: 37,069,174 S290C probably damaging Het
Olfr727 A T 14: 50,127,438 Y287F probably damaging Het
Padi3 C T 4: 140,786,439 E653K probably benign Het
Pde4a A G 9: 21,198,663 E280G possibly damaging Het
Phactr3 G A 2: 178,283,910 R326H probably benign Het
Prob1 G A 18: 35,653,344 P619L possibly damaging Het
Ptk2 G A 15: 73,295,375 R368W probably damaging Het
Rgs6 A G 12: 83,069,519 T240A probably benign Het
Rpa1 A T 11: 75,312,809 Y356N probably damaging Het
Rxrb T A 17: 34,033,605 D165E probably damaging Het
Sco1 A G 11: 67,053,802 T84A possibly damaging Het
Sepsecs T C 5: 52,647,189 I380V probably benign Het
Sfmbt1 T A 14: 30,816,802 W793R probably damaging Het
Slco3a1 A G 7: 74,318,596 S459P probably benign Het
Smg1 A T 7: 118,171,939 S1503R possibly damaging Het
Sox2 G A 3: 34,650,642 R76H probably damaging Het
Spty2d1 G A 7: 46,996,056 S613F probably damaging Het
Stab2 A T 10: 86,957,912 Y440N probably damaging Het
Syn3 A G 10: 86,080,253 Y290H probably damaging Het
Tgtp1 A G 11: 48,987,332 F182S probably benign Het
Tmcc1 A T 6: 116,043,578 S304R Het
Tmem130 T G 5: 144,743,770 K275Q probably damaging Het
Tmem9 C A 1: 136,034,189 T174K probably damaging Het
Ttyh3 C T 5: 140,634,783 R233Q probably damaging Het
Twnk T C 19: 45,007,668 M180T probably benign Het
Ube4a A G 9: 44,933,331 V874A probably damaging Het
Ugt2a3 T C 5: 87,327,723 N350S probably damaging Het
Vegfa C T 17: 46,031,835 G19D probably damaging Het
Vmn2r2 C A 3: 64,134,097 C399F possibly damaging Het
Vmn2r65 G T 7: 84,946,322 P385T probably benign Het
Vmn2r65 A G 7: 84,946,984 F164S probably damaging Het
Zcchc6 A T 13: 59,815,575 M323K possibly damaging Het
Other mutations in Tex15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Tex15 APN 8 33575311 missense probably benign 0.18
IGL00705:Tex15 APN 8 33581592 missense probably damaging 1.00
IGL00820:Tex15 APN 8 33579006 splice site probably benign
IGL01288:Tex15 APN 8 33571384 missense probably benign 0.02
IGL01328:Tex15 APN 8 33571396 nonsense probably null
IGL01359:Tex15 APN 8 33581898 missense probably damaging 0.99
IGL01603:Tex15 APN 8 33573547 missense possibly damaging 0.93
IGL01861:Tex15 APN 8 33570689 missense probably damaging 1.00
IGL02052:Tex15 APN 8 33582465 missense probably benign 0.28
IGL02560:Tex15 APN 8 33581751 missense probably benign 0.00
IGL02677:Tex15 APN 8 33571080 missense probably benign 0.03
IGL02739:Tex15 APN 8 33581693 missense possibly damaging 0.68
Big_gulp UTSW 8 33581734 missense probably damaging 1.00
P0005:Tex15 UTSW 8 33570868 missense probably benign 0.00
P0037:Tex15 UTSW 8 33581580 missense probably benign 0.00
PIT4377001:Tex15 UTSW 8 33571101 missense probably damaging 1.00
R0056:Tex15 UTSW 8 33582027 missense probably benign 0.00
R0056:Tex15 UTSW 8 33582027 missense probably benign 0.00
R0058:Tex15 UTSW 8 33581502 splice site probably benign
R0058:Tex15 UTSW 8 33581502 splice site probably benign
R0595:Tex15 UTSW 8 33572617 missense probably damaging 1.00
R0646:Tex15 UTSW 8 33582326 missense possibly damaging 0.83
R0688:Tex15 UTSW 8 33573500 missense probably damaging 1.00
R0842:Tex15 UTSW 8 33571547 missense possibly damaging 0.95
R0987:Tex15 UTSW 8 33576847 missense probably damaging 1.00
R1084:Tex15 UTSW 8 33577004 missense probably benign 0.28
R1183:Tex15 UTSW 8 33574865 missense probably benign 0.35
R1186:Tex15 UTSW 8 33571633 missense probably benign 0.19
R1378:Tex15 UTSW 8 33575216 missense probably damaging 0.99
R1500:Tex15 UTSW 8 33575092 missense probably damaging 0.96
R1508:Tex15 UTSW 8 33576852 missense probably damaging 1.00
R1597:Tex15 UTSW 8 33571483 missense probably damaging 0.96
R1636:Tex15 UTSW 8 33576387 nonsense probably null
R1639:Tex15 UTSW 8 33570817 missense possibly damaging 0.94
R1809:Tex15 UTSW 8 33574234 missense probably benign
R1843:Tex15 UTSW 8 33576654 missense probably benign 0.27
R2029:Tex15 UTSW 8 33571274 missense probably damaging 0.99
R2228:Tex15 UTSW 8 33571237 missense probably benign 0.05
R2229:Tex15 UTSW 8 33571237 missense probably benign 0.05
R2245:Tex15 UTSW 8 33571496 missense possibly damaging 0.77
R2246:Tex15 UTSW 8 33582512 missense possibly damaging 0.49
R2880:Tex15 UTSW 8 33574907 nonsense probably null
R2881:Tex15 UTSW 8 33574907 nonsense probably null
R2882:Tex15 UTSW 8 33574907 nonsense probably null
R3001:Tex15 UTSW 8 33574528 missense probably benign 0.15
R3002:Tex15 UTSW 8 33574528 missense probably benign 0.15
R3020:Tex15 UTSW 8 33576670 missense probably damaging 1.00
R3084:Tex15 UTSW 8 33574885 missense probably benign 0.11
R3085:Tex15 UTSW 8 33574885 missense probably benign 0.11
R3701:Tex15 UTSW 8 33574166 missense probably benign 0.00
R3702:Tex15 UTSW 8 33574166 missense probably benign 0.00
R3752:Tex15 UTSW 8 33571415 missense probably benign
R4162:Tex15 UTSW 8 33581558 missense probably damaging 1.00
R4231:Tex15 UTSW 8 33572137 missense probably damaging 0.99
R4589:Tex15 UTSW 8 33557373 missense probably damaging 1.00
R4707:Tex15 UTSW 8 33582497 missense probably benign 0.00
R4773:Tex15 UTSW 8 33582732 missense probably benign 0.42
R4967:Tex15 UTSW 8 33574470 missense probably benign 0.34
R5063:Tex15 UTSW 8 33582610 missense possibly damaging 0.59
R5121:Tex15 UTSW 8 33571766 missense probably damaging 1.00
R5147:Tex15 UTSW 8 33572312 nonsense probably null
R5166:Tex15 UTSW 8 33576392 missense probably benign 0.07
R5173:Tex15 UTSW 8 33571740 missense possibly damaging 0.73
R5439:Tex15 UTSW 8 33574171 missense possibly damaging 0.93
R5537:Tex15 UTSW 8 33571613 missense probably damaging 1.00
R5580:Tex15 UTSW 8 33572429 missense probably damaging 1.00
R5588:Tex15 UTSW 8 33577187 missense probably damaging 1.00
R5696:Tex15 UTSW 8 33573192 missense probably benign 0.01
R5734:Tex15 UTSW 8 33546336 missense probably benign 0.01
R5756:Tex15 UTSW 8 33575833 missense probably benign 0.17
R5823:Tex15 UTSW 8 33570934 missense possibly damaging 0.67
R6126:Tex15 UTSW 8 33573563 missense probably benign 0.19
R6129:Tex15 UTSW 8 33574130 missense possibly damaging 0.90
R6276:Tex15 UTSW 8 33577189 missense possibly damaging 0.93
R6374:Tex15 UTSW 8 33575912 missense probably damaging 1.00
R6430:Tex15 UTSW 8 33571301 missense probably benign 0.01
R6452:Tex15 UTSW 8 33572816 missense probably damaging 1.00
R6471:Tex15 UTSW 8 33581734 missense probably damaging 1.00
R6700:Tex15 UTSW 8 33574889 missense possibly damaging 0.93
R6918:Tex15 UTSW 8 33573184 missense probably benign 0.27
R6958:Tex15 UTSW 8 33570871 missense probably benign 0.01
R6970:Tex15 UTSW 8 33557428 missense probably benign 0.03
R7059:Tex15 UTSW 8 33574730 missense possibly damaging 0.57
R7069:Tex15 UTSW 8 33570720 missense probably benign
R7072:Tex15 UTSW 8 33575431 missense possibly damaging 0.85
R7212:Tex15 UTSW 8 33570826 nonsense probably null
R7212:Tex15 UTSW 8 33572995 missense probably damaging 1.00
R7216:Tex15 UTSW 8 33572986 missense possibly damaging 0.93
R7219:Tex15 UTSW 8 33546240 missense probably benign 0.40
R7313:Tex15 UTSW 8 33574817 missense possibly damaging 0.82
R7315:Tex15 UTSW 8 33581516 missense probably benign 0.01
R7444:Tex15 UTSW 8 33576562 missense possibly damaging 0.92
R7455:Tex15 UTSW 8 33576997 missense possibly damaging 0.91
R7643:Tex15 UTSW 8 33575120 missense probably damaging 1.00
R7644:Tex15 UTSW 8 33574417 missense probably benign 0.01
R7724:Tex15 UTSW 8 33546263 missense possibly damaging 0.60
R7779:Tex15 UTSW 8 33575281 missense probably damaging 1.00
R7816:Tex15 UTSW 8 33581655 missense probably benign 0.14
R7820:Tex15 UTSW 8 33575062 missense probably damaging 0.98
R8041:Tex15 UTSW 8 33575846 missense probably damaging 1.00
RF005:Tex15 UTSW 8 33576677 missense probably benign 0.05
X0020:Tex15 UTSW 8 33576579 missense probably benign 0.03
X0065:Tex15 UTSW 8 33575517 nonsense probably null
Z1088:Tex15 UTSW 8 33571315 missense possibly damaging 0.89
Z1088:Tex15 UTSW 8 33571810 missense possibly damaging 0.68
Z1088:Tex15 UTSW 8 33574870 missense probably benign
Z1176:Tex15 UTSW 8 33574726 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- TGTCACCTGCTGAAAGTGTAC -3'
(R):5'- TGGTGAAAGTCTGTGCCACTC -3'

Sequencing Primer
(F):5'- GTCACCTGCTGAAAGTGTACAAGAC -3'
(R):5'- CAAATAAACGTCCTTCTCTGACTGGG -3'
Posted On2019-11-26