Incidental Mutation 'R7798:Adamts15'
ID600368
Institutional Source Beutler Lab
Gene Symbol Adamts15
Ensembl Gene ENSMUSG00000033453
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 15
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7798 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location30899155-30922452 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 30904643 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 639 (T639M)
Ref Sequence ENSEMBL: ENSMUSP00000067022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065112]
Predicted Effect probably damaging
Transcript: ENSMUST00000065112
AA Change: T639M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000067022
Gene: ENSMUSG00000033453
AA Change: T639M

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Pep_M12B_propep 24 157 8.7e-27 PFAM
Pfam:Reprolysin_4 216 422 8.2e-7 PFAM
Pfam:Reprolysin_5 217 404 7.2e-13 PFAM
Pfam:Reprolysin 218 427 3.7e-20 PFAM
Pfam:Reprolysin_3 240 372 6.1e-10 PFAM
Blast:ACR 429 507 1e-25 BLAST
TSP1 519 571 7.85e-12 SMART
Pfam:ADAM_spacer1 683 801 7.1e-36 PFAM
TSP1 842 895 3e-8 SMART
TSP1 896 949 4.21e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active versicanase enzyme. This gene is located adjacent to a related ADAMTS gene (Adamts8) on chromosome 9. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700088E04Rik T A 15: 79,135,732 N128I probably damaging Het
5830473C10Rik T C 5: 90,597,511 S608P possibly damaging Het
Abca13 A G 11: 9,291,664 T1176A probably benign Het
Abca9 A G 11: 110,138,179 V851A probably benign Het
Abcc6 C A 7: 45,976,853 E1494* probably null Het
Adamts14 A T 10: 61,271,173 V56E probably damaging Het
Arhgap11a A C 2: 113,843,335 V70G probably damaging Het
BC051665 A T 13: 60,784,435 D113E probably benign Het
Best1 T C 19: 9,991,671 Y227C probably damaging Het
Camk2b A G 11: 5,978,399 S447P probably benign Het
Ccdc88a C A 11: 29,477,348 Q1018K probably benign Het
Cfap74 T A 4: 155,422,622 V180D Het
Clca3a1 T A 3: 144,757,962 T185S probably damaging Het
Clca3b T C 3: 144,828,130 S495G probably damaging Het
Cyb5r2 A T 7: 107,753,948 Y96N possibly damaging Het
Cyp21a1 T C 17: 34,804,321 K27E probably benign Het
Cyp2ab1 T C 16: 20,312,416 E321G probably benign Het
Des T C 1: 75,362,359 I228T probably damaging Het
Dis3l G T 9: 64,341,017 P39T probably benign Het
Disp2 A C 2: 118,791,879 I1031L probably benign Het
Ell3 TCTCCTC TCTC 2: 121,439,456 probably benign Het
Etl4 G A 2: 20,781,946 probably null Het
Fgf23 A T 6: 127,073,214 D62V probably damaging Het
Galnt15 C T 14: 32,029,905 T138I possibly damaging Het
Ggt6 A T 11: 72,435,541 probably benign Het
Gm28710 T C 5: 16,856,658 F801L possibly damaging Het
Gm9573 C G 17: 35,621,254 G680A unknown Het
Gpr180 T A 14: 118,153,686 V209D probably damaging Het
Gzma A T 13: 113,096,324 F78Y probably benign Het
Igkv8-30 A T 6: 70,117,371 C19S probably benign Het
Il1r1 G A 1: 40,310,366 V361I probably benign Het
Intu T C 3: 40,691,929 V598A probably damaging Het
Itpr2 A G 6: 146,386,015 F471L probably benign Het
Kntc1 T A 5: 123,786,294 V1081E probably benign Het
Kntc1 T A 5: 123,819,117 V2163E possibly damaging Het
Macf1 T C 4: 123,378,100 K6552E probably damaging Het
Marf1 T C 16: 14,138,451 H842R probably benign Het
Mgat4b A G 11: 50,225,670 T10A possibly damaging Het
Muc5ac T C 7: 141,794,041 probably null Het
Nrk CGCAGCAGCAGCAGCAGCAGC CGCAGCAGCAGCAGCAGC X: 138,982,677 probably benign Het
Nsun4 T G 4: 116,051,174 S730R possibly damaging Het
Olfr1112 A T 2: 87,192,292 I202L probably benign Het
Olfr1310 A G 2: 112,008,272 F305L probably benign Het
Olfr351 T C 2: 36,860,336 E4G probably benign Het
Olfr360 A T 2: 37,069,174 S290C probably damaging Het
Olfr727 A T 14: 50,127,438 Y287F probably damaging Het
Padi3 C T 4: 140,786,439 E653K probably benign Het
Pde4a A G 9: 21,198,663 E280G possibly damaging Het
Phactr3 G A 2: 178,283,910 R326H probably benign Het
Prob1 G A 18: 35,653,344 P619L possibly damaging Het
Ptk2 G A 15: 73,295,375 R368W probably damaging Het
Rgs6 A G 12: 83,069,519 T240A probably benign Het
Rpa1 A T 11: 75,312,809 Y356N probably damaging Het
Rxrb T A 17: 34,033,605 D165E probably damaging Het
Sco1 A G 11: 67,053,802 T84A possibly damaging Het
Sepsecs T C 5: 52,647,189 I380V probably benign Het
Sfmbt1 T A 14: 30,816,802 W793R probably damaging Het
Slco3a1 A G 7: 74,318,596 S459P probably benign Het
Smg1 A T 7: 118,171,939 S1503R possibly damaging Het
Sox2 G A 3: 34,650,642 R76H probably damaging Het
Spty2d1 G A 7: 46,996,056 S613F probably damaging Het
Stab2 A T 10: 86,957,912 Y440N probably damaging Het
Syn3 A G 10: 86,080,253 Y290H probably damaging Het
Tex15 C T 8: 33,581,847 S2474F possibly damaging Het
Tgtp1 A G 11: 48,987,332 F182S probably benign Het
Tmcc1 A T 6: 116,043,578 S304R Het
Tmem130 T G 5: 144,743,770 K275Q probably damaging Het
Tmem9 C A 1: 136,034,189 T174K probably damaging Het
Ttyh3 C T 5: 140,634,783 R233Q probably damaging Het
Twnk T C 19: 45,007,668 M180T probably benign Het
Ube4a A G 9: 44,933,331 V874A probably damaging Het
Ugt2a3 T C 5: 87,327,723 N350S probably damaging Het
Vegfa C T 17: 46,031,835 G19D probably damaging Het
Vmn2r2 C A 3: 64,134,097 C399F possibly damaging Het
Vmn2r65 G T 7: 84,946,322 P385T probably benign Het
Vmn2r65 A G 7: 84,946,984 F164S probably damaging Het
Zcchc6 A T 13: 59,815,575 M323K possibly damaging Het
Other mutations in Adamts15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00930:Adamts15 APN 9 30902053 missense probably damaging 1.00
IGL01325:Adamts15 APN 9 30921688 missense possibly damaging 0.86
IGL01506:Adamts15 APN 9 30922134 missense probably benign 0.08
IGL01897:Adamts15 APN 9 30902152 missense probably damaging 1.00
IGL02137:Adamts15 APN 9 30910660 missense probably damaging 1.00
IGL02876:Adamts15 APN 9 30904522 missense probably damaging 0.98
IGL02997:Adamts15 APN 9 30906057 splice site probably benign
IGL03094:Adamts15 APN 9 30904472 splice site probably benign
IGL03146:Adamts15 APN 9 30921567 missense probably damaging 0.99
IGL03241:Adamts15 APN 9 30904485 missense probably damaging 1.00
R0118:Adamts15 UTSW 9 30911744 missense probably damaging 1.00
R0635:Adamts15 UTSW 9 30904770 missense probably damaging 1.00
R0827:Adamts15 UTSW 9 30921480 missense probably damaging 1.00
R0946:Adamts15 UTSW 9 30902197 missense probably damaging 1.00
R1608:Adamts15 UTSW 9 30902479 missense probably damaging 0.99
R1806:Adamts15 UTSW 9 30904815 missense probably damaging 1.00
R1954:Adamts15 UTSW 9 30910708 missense probably benign
R1967:Adamts15 UTSW 9 30921309 nonsense probably null
R2009:Adamts15 UTSW 9 30922137 missense probably benign 0.17
R2129:Adamts15 UTSW 9 30904503 missense probably benign 0.05
R2329:Adamts15 UTSW 9 30902485 missense probably damaging 1.00
R2991:Adamts15 UTSW 9 30921394 missense probably benign
R3970:Adamts15 UTSW 9 30910602 missense probably benign 0.40
R4212:Adamts15 UTSW 9 30906174 missense probably damaging 0.99
R4326:Adamts15 UTSW 9 30904518 missense probably benign
R4329:Adamts15 UTSW 9 30904518 missense probably benign
R4594:Adamts15 UTSW 9 30921447 missense probably damaging 0.99
R5110:Adamts15 UTSW 9 30921444 missense probably benign 0.01
R5120:Adamts15 UTSW 9 30921576 missense probably damaging 1.00
R5697:Adamts15 UTSW 9 30911794 missense probably damaging 1.00
R5901:Adamts15 UTSW 9 30902490 missense probably damaging 1.00
R6011:Adamts15 UTSW 9 30902786 missense probably damaging 0.98
R6020:Adamts15 UTSW 9 30902062 missense probably benign 0.03
R6651:Adamts15 UTSW 9 30922152 missense probably damaging 0.98
R6665:Adamts15 UTSW 9 30904479 critical splice donor site probably null
R7021:Adamts15 UTSW 9 30921480 missense probably damaging 1.00
R7231:Adamts15 UTSW 9 30906158 missense probably damaging 1.00
R7290:Adamts15 UTSW 9 30902610 missense probably benign 0.05
R7390:Adamts15 UTSW 9 30911108 critical splice donor site probably null
R7833:Adamts15 UTSW 9 30922105 missense probably benign
R7908:Adamts15 UTSW 9 30902226 missense probably benign
R7916:Adamts15 UTSW 9 30922105 missense probably benign
R7989:Adamts15 UTSW 9 30902226 missense probably benign
X0063:Adamts15 UTSW 9 30922230 missense possibly damaging 0.96
X0067:Adamts15 UTSW 9 30921582 missense probably damaging 1.00
Z1176:Adamts15 UTSW 9 30910700 missense probably damaging 1.00
Z1177:Adamts15 UTSW 9 30902491 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAGAGCTTACATAGGCTTG -3'
(R):5'- ACTTTAGCTGTGGCATGGGTAC -3'

Sequencing Primer
(F):5'- CTTGGTGAAGAGTCCTGTCACC -3'
(R):5'- GTGACAAGTGTAAGCTCATCTGCC -3'
Posted On2019-11-26