Incidental Mutation 'R7798:Ccdc88a'
ID600376
Institutional Source Beutler Lab
Gene Symbol Ccdc88a
Ensembl Gene ENSMUSG00000032740
Gene Namecoiled coil domain containing 88A
SynonymsGirdin, GIV, A430106J12Rik, D130005J21Rik, HkRP1, C130096N06Rik, C330012F17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7798 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location29373658-29510808 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 29477348 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 1018 (Q1018K)
Ref Sequence ENSEMBL: ENSMUSP00000048978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040182] [ENSMUST00000155854]
Predicted Effect probably benign
Transcript: ENSMUST00000040182
AA Change: Q1018K

PolyPhen 2 Score 0.153 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000048978
Gene: ENSMUSG00000032740
AA Change: Q1018K

DomainStartEndE-ValueType
Pfam:HOOK 14 590 8.1e-36 PFAM
low complexity region 614 625 N/A INTRINSIC
Blast:BRLZ 665 719 6e-22 BLAST
low complexity region 826 839 N/A INTRINSIC
low complexity region 883 895 N/A INTRINSIC
low complexity region 955 985 N/A INTRINSIC
low complexity region 1093 1104 N/A INTRINSIC
coiled coil region 1268 1385 N/A INTRINSIC
low complexity region 1437 1444 N/A INTRINSIC
low complexity region 1566 1576 N/A INTRINSIC
internal_repeat_1 1609 1702 2.38e-6 PROSPERO
internal_repeat_1 1708 1808 2.38e-6 PROSPERO
low complexity region 1811 1824 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123561
SMART Domains Protein: ENSMUSP00000119173
Gene: ENSMUSG00000032740

DomainStartEndE-ValueType
coiled coil region 1 212 N/A INTRINSIC
coiled coil region 248 365 N/A INTRINSIC
low complexity region 418 425 N/A INTRINSIC
low complexity region 547 557 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000155854
AA Change: Q209K

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000115117
Gene: ENSMUSG00000032740
AA Change: Q209K

DomainStartEndE-ValueType
low complexity region 18 31 N/A INTRINSIC
low complexity region 75 87 N/A INTRINSIC
low complexity region 146 176 N/A INTRINSIC
Blast:BRLZ 228 283 7e-6 BLAST
low complexity region 284 295 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Girdin family of coiled-coil domain containing proteins. The encoded protein is an actin-binding protein that is activated by the serine/threonine kinase Akt and plays a role in cytoskeleton remodeling and cell migration. The encoded protein also enhances Akt signaling by mediating phosphoinositide 3-kinase (PI3K)-dependent activation of Akt by growth factor receptor tyrosine kinases and G protein-coupled receptors. Increased expression of this gene and phosphorylation of the encoded protein may play a role in cancer metastasis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal weight loss, reduced angiogenesis, and premature death by P25. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700088E04Rik T A 15: 79,135,732 N128I probably damaging Het
5830473C10Rik T C 5: 90,597,511 S608P possibly damaging Het
Abca13 A G 11: 9,291,664 T1176A probably benign Het
Abca9 A G 11: 110,138,179 V851A probably benign Het
Abcc6 C A 7: 45,976,853 E1494* probably null Het
Adamts14 A T 10: 61,271,173 V56E probably damaging Het
Adamts15 G A 9: 30,904,643 T639M probably damaging Het
Arhgap11a A C 2: 113,843,335 V70G probably damaging Het
BC051665 A T 13: 60,784,435 D113E probably benign Het
Best1 T C 19: 9,991,671 Y227C probably damaging Het
Camk2b A G 11: 5,978,399 S447P probably benign Het
Cfap74 T A 4: 155,422,622 V180D Het
Clca3a1 T A 3: 144,757,962 T185S probably damaging Het
Clca3b T C 3: 144,828,130 S495G probably damaging Het
Cyb5r2 A T 7: 107,753,948 Y96N possibly damaging Het
Cyp21a1 T C 17: 34,804,321 K27E probably benign Het
Cyp2ab1 T C 16: 20,312,416 E321G probably benign Het
Des T C 1: 75,362,359 I228T probably damaging Het
Dis3l G T 9: 64,341,017 P39T probably benign Het
Disp2 A C 2: 118,791,879 I1031L probably benign Het
Ell3 TCTCCTC TCTC 2: 121,439,456 probably benign Het
Etl4 G A 2: 20,781,946 probably null Het
Fgf23 A T 6: 127,073,214 D62V probably damaging Het
Galnt15 C T 14: 32,029,905 T138I possibly damaging Het
Ggt6 A T 11: 72,435,541 probably benign Het
Gm28710 T C 5: 16,856,658 F801L possibly damaging Het
Gm9573 C G 17: 35,621,254 G680A unknown Het
Gpr180 T A 14: 118,153,686 V209D probably damaging Het
Gzma A T 13: 113,096,324 F78Y probably benign Het
Igkv8-30 A T 6: 70,117,371 C19S probably benign Het
Il1r1 G A 1: 40,310,366 V361I probably benign Het
Intu T C 3: 40,691,929 V598A probably damaging Het
Itpr2 A G 6: 146,386,015 F471L probably benign Het
Kntc1 T A 5: 123,786,294 V1081E probably benign Het
Kntc1 T A 5: 123,819,117 V2163E possibly damaging Het
Macf1 T C 4: 123,378,100 K6552E probably damaging Het
Marf1 T C 16: 14,138,451 H842R probably benign Het
Mgat4b A G 11: 50,225,670 T10A possibly damaging Het
Muc5ac T C 7: 141,794,041 probably null Het
Nrk CGCAGCAGCAGCAGCAGCAGC CGCAGCAGCAGCAGCAGC X: 138,982,677 probably benign Het
Nsun4 T G 4: 116,051,174 S730R possibly damaging Het
Olfr1112 A T 2: 87,192,292 I202L probably benign Het
Olfr1310 A G 2: 112,008,272 F305L probably benign Het
Olfr351 T C 2: 36,860,336 E4G probably benign Het
Olfr360 A T 2: 37,069,174 S290C probably damaging Het
Olfr727 A T 14: 50,127,438 Y287F probably damaging Het
Padi3 C T 4: 140,786,439 E653K probably benign Het
Pde4a A G 9: 21,198,663 E280G possibly damaging Het
Phactr3 G A 2: 178,283,910 R326H probably benign Het
Prob1 G A 18: 35,653,344 P619L possibly damaging Het
Ptk2 G A 15: 73,295,375 R368W probably damaging Het
Rgs6 A G 12: 83,069,519 T240A probably benign Het
Rpa1 A T 11: 75,312,809 Y356N probably damaging Het
Rxrb T A 17: 34,033,605 D165E probably damaging Het
Sco1 A G 11: 67,053,802 T84A possibly damaging Het
Sepsecs T C 5: 52,647,189 I380V probably benign Het
Sfmbt1 T A 14: 30,816,802 W793R probably damaging Het
Slco3a1 A G 7: 74,318,596 S459P probably benign Het
Smg1 A T 7: 118,171,939 S1503R possibly damaging Het
Sox2 G A 3: 34,650,642 R76H probably damaging Het
Spty2d1 G A 7: 46,996,056 S613F probably damaging Het
Stab2 A T 10: 86,957,912 Y440N probably damaging Het
Syn3 A G 10: 86,080,253 Y290H probably damaging Het
Tex15 C T 8: 33,581,847 S2474F possibly damaging Het
Tgtp1 A G 11: 48,987,332 F182S probably benign Het
Tmcc1 A T 6: 116,043,578 S304R Het
Tmem130 T G 5: 144,743,770 K275Q probably damaging Het
Tmem9 C A 1: 136,034,189 T174K probably damaging Het
Ttyh3 C T 5: 140,634,783 R233Q probably damaging Het
Twnk T C 19: 45,007,668 M180T probably benign Het
Ube4a A G 9: 44,933,331 V874A probably damaging Het
Ugt2a3 T C 5: 87,327,723 N350S probably damaging Het
Vegfa C T 17: 46,031,835 G19D probably damaging Het
Vmn2r2 C A 3: 64,134,097 C399F possibly damaging Het
Vmn2r65 G T 7: 84,946,322 P385T probably benign Het
Vmn2r65 A G 7: 84,946,984 F164S probably damaging Het
Zcchc6 A T 13: 59,815,575 M323K possibly damaging Het
Other mutations in Ccdc88a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Ccdc88a APN 11 29499341 missense probably benign 0.24
IGL00577:Ccdc88a APN 11 29424772 missense probably damaging 1.00
IGL00766:Ccdc88a APN 11 29501046 missense probably damaging 0.99
IGL01384:Ccdc88a APN 11 29503915 missense probably damaging 0.99
IGL01541:Ccdc88a APN 11 29400283 missense probably benign
IGL01647:Ccdc88a APN 11 29504321 unclassified probably benign
IGL02648:Ccdc88a APN 11 29501051 missense probably benign 0.28
IGL02885:Ccdc88a APN 11 29448050 missense probably damaging 1.00
IGL03117:Ccdc88a APN 11 29374559 missense probably damaging 1.00
IGL03196:Ccdc88a APN 11 29482340 missense possibly damaging 0.56
trailor UTSW 11 29494099 splice site probably null
R0011:Ccdc88a UTSW 11 29374364 missense probably damaging 1.00
R0011:Ccdc88a UTSW 11 29374364 missense probably damaging 1.00
R0083:Ccdc88a UTSW 11 29503463 missense probably damaging 0.99
R0108:Ccdc88a UTSW 11 29503463 missense probably damaging 0.99
R0326:Ccdc88a UTSW 11 29461021 missense probably benign 0.01
R0565:Ccdc88a UTSW 11 29461042 unclassified probably benign
R0631:Ccdc88a UTSW 11 29493752 missense probably damaging 0.98
R0632:Ccdc88a UTSW 11 29482749 unclassified probably benign
R0762:Ccdc88a UTSW 11 29463112 unclassified probably benign
R0838:Ccdc88a UTSW 11 29400285 missense probably damaging 1.00
R0946:Ccdc88a UTSW 11 29456509 missense probably benign
R1192:Ccdc88a UTSW 11 29504049 missense possibly damaging 0.45
R1500:Ccdc88a UTSW 11 29482713 missense probably benign 0.00
R1701:Ccdc88a UTSW 11 29477427 missense possibly damaging 0.59
R1826:Ccdc88a UTSW 11 29489637 missense possibly damaging 0.58
R1902:Ccdc88a UTSW 11 29461788 missense probably benign 0.07
R1903:Ccdc88a UTSW 11 29461788 missense probably benign 0.07
R2021:Ccdc88a UTSW 11 29503480 missense probably damaging 1.00
R2023:Ccdc88a UTSW 11 29463546 nonsense probably null
R2284:Ccdc88a UTSW 11 29494099 splice site probably null
R3236:Ccdc88a UTSW 11 29447995 missense possibly damaging 0.51
R3409:Ccdc88a UTSW 11 29486006 missense probably damaging 1.00
R3410:Ccdc88a UTSW 11 29486006 missense probably damaging 1.00
R3411:Ccdc88a UTSW 11 29486006 missense probably damaging 1.00
R3430:Ccdc88a UTSW 11 29448033 missense probably damaging 0.98
R3620:Ccdc88a UTSW 11 29430227 missense probably benign 0.16
R4204:Ccdc88a UTSW 11 29463399 missense probably damaging 1.00
R4515:Ccdc88a UTSW 11 29482651 missense probably benign 0.01
R4518:Ccdc88a UTSW 11 29482651 missense probably benign 0.01
R4519:Ccdc88a UTSW 11 29482651 missense probably benign 0.01
R4693:Ccdc88a UTSW 11 29482241 missense probably damaging 1.00
R4705:Ccdc88a UTSW 11 29422586 missense probably benign
R4707:Ccdc88a UTSW 11 29447956 missense probably benign
R4732:Ccdc88a UTSW 11 29485906 missense probably benign 0.02
R4733:Ccdc88a UTSW 11 29485906 missense probably benign 0.02
R4734:Ccdc88a UTSW 11 29482720 missense probably benign
R4749:Ccdc88a UTSW 11 29482720 missense probably benign
R4817:Ccdc88a UTSW 11 29460907 missense probably benign 0.15
R4828:Ccdc88a UTSW 11 29463210 missense probably damaging 1.00
R4979:Ccdc88a UTSW 11 29482133 nonsense probably null
R5288:Ccdc88a UTSW 11 29498416 missense possibly damaging 0.77
R5373:Ccdc88a UTSW 11 29463409 missense possibly damaging 0.92
R5374:Ccdc88a UTSW 11 29463409 missense possibly damaging 0.92
R5401:Ccdc88a UTSW 11 29463279 missense probably benign 0.00
R5586:Ccdc88a UTSW 11 29503484 missense probably benign 0.00
R6660:Ccdc88a UTSW 11 29482663 missense probably benign 0.01
R7116:Ccdc88a UTSW 11 29504051 missense probably benign 0.01
R7353:Ccdc88a UTSW 11 29463368 missense probably benign 0.00
R7538:Ccdc88a UTSW 11 29463370 missense probably benign 0.00
R7663:Ccdc88a UTSW 11 29498614 critical splice donor site probably null
R7769:Ccdc88a UTSW 11 29482381 missense probably damaging 1.00
R7810:Ccdc88a UTSW 11 29485964 missense probably damaging 1.00
R7826:Ccdc88a UTSW 11 29503563 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AAGAGCTTTTGATCACATTAAGGG -3'
(R):5'- GGAGCAAAGCATACTAAATCTAGATC -3'

Sequencing Primer
(F):5'- TTGATCACATTAAGGGTAATCACAC -3'
(R):5'- ACTTCAATTAACCTGTCTT -3'
Posted On2019-11-26