Incidental Mutation 'R7798:Vegfa'
ID600398
Institutional Source Beutler Lab
Gene Symbol Vegfa
Ensembl Gene ENSMUSG00000023951
Gene Namevascular endothelial growth factor A
SynonymsVEGF-A, VPF, VEGF164, VEGF120, VEGF188, Vegf
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7798 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location46016993-46032369 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 46031835 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 19 (G19D)
Ref Sequence ENSEMBL: ENSMUSP00000115883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024747] [ENSMUST00000071648] [ENSMUST00000113519] [ENSMUST00000113520] [ENSMUST00000142351] [ENSMUST00000167860] [ENSMUST00000214739] [ENSMUST00000217017]
Predicted Effect probably benign
Transcript: ENSMUST00000024747
SMART Domains Protein: ENSMUSP00000024747
Gene: ENSMUSG00000023951

DomainStartEndE-ValueType
PDGF 49 131 1.48e-49 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000071648
AA Change: G19D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071575
Gene: ENSMUSG00000023951
AA Change: G19D

DomainStartEndE-ValueType
low complexity region 31 51 N/A INTRINSIC
low complexity region 60 71 N/A INTRINSIC
low complexity region 87 105 N/A INTRINSIC
low complexity region 121 143 N/A INTRINSIC
low complexity region 158 176 N/A INTRINSIC
PDGF 227 309 1.48e-49 SMART
Pfam:VEGF_C 312 368 2.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113519
SMART Domains Protein: ENSMUSP00000109147
Gene: ENSMUSG00000023951

DomainStartEndE-ValueType
PDGF 49 131 1.48e-49 SMART
low complexity region 140 161 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113520
SMART Domains Protein: ENSMUSP00000109148
Gene: ENSMUSG00000023951

DomainStartEndE-ValueType
PDGF 49 131 1.48e-49 SMART
Pfam:VEGF_C 154 208 9.5e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000142351
AA Change: G19D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115883
Gene: ENSMUSG00000023951
AA Change: G19D

DomainStartEndE-ValueType
low complexity region 31 51 N/A INTRINSIC
low complexity region 60 71 N/A INTRINSIC
low complexity region 87 105 N/A INTRINSIC
low complexity region 121 143 N/A INTRINSIC
low complexity region 158 176 N/A INTRINSIC
PDGF 227 309 1.48e-49 SMART
Pfam:VEGF_C 339 392 1.9e-31 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167860
AA Change: G19D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131901
Gene: ENSMUSG00000023951
AA Change: G19D

DomainStartEndE-ValueType
low complexity region 31 51 N/A INTRINSIC
low complexity region 60 71 N/A INTRINSIC
low complexity region 87 105 N/A INTRINSIC
low complexity region 121 143 N/A INTRINSIC
low complexity region 158 176 N/A INTRINSIC
PDGF 227 309 1.48e-49 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000214739
AA Change: G19D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000217017
AA Change: G19D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene is a member of the PDGF/VEGF growth factor family. It encodes a heparin-binding protein, which exists as a disulfide-linked homodimer. This growth factor induces proliferation and migration of vascular endothelial cells, and is essential for both physiological and pathological angiogenesis. Disruption of this gene in mice resulted in abnormal embryonic blood vessel formation. This gene is upregulated in many known tumors and its expression is correlated with tumor stage and progression. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. There is also evidence for alternative translation initiation from upstream non-AUG (CUG) codons resulting in additional isoforms. A recent study showed that a C-terminally extended isoform is produced by use of an alternative in-frame translation termination codon via a stop codon readthrough mechanism, and that this isoform is antiangiogenic. Expression of some isoforms derived from the AUG start codon is regulated by a small upstream open reading frame, which is located within an internal ribosome entry site.[provided by RefSeq, Nov 2015]
PHENOTYPE: Hetero- or homozygous null mutants show embryonic lethality with impaired angiogenesis and blood-island formation. Mutants selectively expressing isoform 120 or 188 exhibit vascular outgrowth/patterning defects or impaired arterial development, respectively. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700088E04Rik T A 15: 79,135,732 N128I probably damaging Het
5830473C10Rik T C 5: 90,597,511 S608P possibly damaging Het
Abca13 A G 11: 9,291,664 T1176A probably benign Het
Abca9 A G 11: 110,138,179 V851A probably benign Het
Abcc6 C A 7: 45,976,853 E1494* probably null Het
Adamts14 A T 10: 61,271,173 V56E probably damaging Het
Adamts15 G A 9: 30,904,643 T639M probably damaging Het
Arhgap11a A C 2: 113,843,335 V70G probably damaging Het
BC051665 A T 13: 60,784,435 D113E probably benign Het
Best1 T C 19: 9,991,671 Y227C probably damaging Het
Camk2b A G 11: 5,978,399 S447P probably benign Het
Ccdc88a C A 11: 29,477,348 Q1018K probably benign Het
Cfap74 T A 4: 155,422,622 V180D Het
Clca3a1 T A 3: 144,757,962 T185S probably damaging Het
Clca3b T C 3: 144,828,130 S495G probably damaging Het
Cyb5r2 A T 7: 107,753,948 Y96N possibly damaging Het
Cyp21a1 T C 17: 34,804,321 K27E probably benign Het
Cyp2ab1 T C 16: 20,312,416 E321G probably benign Het
Des T C 1: 75,362,359 I228T probably damaging Het
Dis3l G T 9: 64,341,017 P39T probably benign Het
Disp2 A C 2: 118,791,879 I1031L probably benign Het
Ell3 TCTCCTC TCTC 2: 121,439,456 probably benign Het
Etl4 G A 2: 20,781,946 probably null Het
Fgf23 A T 6: 127,073,214 D62V probably damaging Het
Galnt15 C T 14: 32,029,905 T138I possibly damaging Het
Ggt6 A T 11: 72,435,541 probably benign Het
Gm28710 T C 5: 16,856,658 F801L possibly damaging Het
Gm9573 C G 17: 35,621,254 G680A unknown Het
Gpr180 T A 14: 118,153,686 V209D probably damaging Het
Gzma A T 13: 113,096,324 F78Y probably benign Het
Igkv8-30 A T 6: 70,117,371 C19S probably benign Het
Il1r1 G A 1: 40,310,366 V361I probably benign Het
Intu T C 3: 40,691,929 V598A probably damaging Het
Itpr2 A G 6: 146,386,015 F471L probably benign Het
Kntc1 T A 5: 123,786,294 V1081E probably benign Het
Kntc1 T A 5: 123,819,117 V2163E possibly damaging Het
Macf1 T C 4: 123,378,100 K6552E probably damaging Het
Marf1 T C 16: 14,138,451 H842R probably benign Het
Mgat4b A G 11: 50,225,670 T10A possibly damaging Het
Muc5ac T C 7: 141,794,041 probably null Het
Nrk CGCAGCAGCAGCAGCAGCAGC CGCAGCAGCAGCAGCAGC X: 138,982,677 probably benign Het
Nsun4 T G 4: 116,051,174 S730R possibly damaging Het
Olfr1112 A T 2: 87,192,292 I202L probably benign Het
Olfr1310 A G 2: 112,008,272 F305L probably benign Het
Olfr351 T C 2: 36,860,336 E4G probably benign Het
Olfr360 A T 2: 37,069,174 S290C probably damaging Het
Olfr727 A T 14: 50,127,438 Y287F probably damaging Het
Padi3 C T 4: 140,786,439 E653K probably benign Het
Pde4a A G 9: 21,198,663 E280G possibly damaging Het
Phactr3 G A 2: 178,283,910 R326H probably benign Het
Prob1 G A 18: 35,653,344 P619L possibly damaging Het
Ptk2 G A 15: 73,295,375 R368W probably damaging Het
Rgs6 A G 12: 83,069,519 T240A probably benign Het
Rpa1 A T 11: 75,312,809 Y356N probably damaging Het
Rxrb T A 17: 34,033,605 D165E probably damaging Het
Sco1 A G 11: 67,053,802 T84A possibly damaging Het
Sepsecs T C 5: 52,647,189 I380V probably benign Het
Sfmbt1 T A 14: 30,816,802 W793R probably damaging Het
Slco3a1 A G 7: 74,318,596 S459P probably benign Het
Smg1 A T 7: 118,171,939 S1503R possibly damaging Het
Sox2 G A 3: 34,650,642 R76H probably damaging Het
Spty2d1 G A 7: 46,996,056 S613F probably damaging Het
Stab2 A T 10: 86,957,912 Y440N probably damaging Het
Syn3 A G 10: 86,080,253 Y290H probably damaging Het
Tex15 C T 8: 33,581,847 S2474F possibly damaging Het
Tgtp1 A G 11: 48,987,332 F182S probably benign Het
Tmcc1 A T 6: 116,043,578 S304R Het
Tmem130 T G 5: 144,743,770 K275Q probably damaging Het
Tmem9 C A 1: 136,034,189 T174K probably damaging Het
Ttyh3 C T 5: 140,634,783 R233Q probably damaging Het
Twnk T C 19: 45,007,668 M180T probably benign Het
Ube4a A G 9: 44,933,331 V874A probably damaging Het
Ugt2a3 T C 5: 87,327,723 N350S probably damaging Het
Vmn2r2 C A 3: 64,134,097 C399F possibly damaging Het
Vmn2r65 G T 7: 84,946,322 P385T probably benign Het
Vmn2r65 A G 7: 84,946,984 F164S probably damaging Het
Zcchc6 A T 13: 59,815,575 M323K possibly damaging Het
Other mutations in Vegfa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01355:Vegfa APN 17 46025421 missense possibly damaging 0.88
IGL02859:Vegfa APN 17 46024495 missense probably benign 0.43
R1442:Vegfa UTSW 17 46025492 missense possibly damaging 0.85
R1760:Vegfa UTSW 17 46025469 missense probably damaging 1.00
R1982:Vegfa UTSW 17 46018860 makesense probably null
R2012:Vegfa UTSW 17 46025358 missense probably benign 0.21
R3729:Vegfa UTSW 17 46024520 missense possibly damaging 0.80
R4276:Vegfa UTSW 17 46031466 missense probably benign
R4277:Vegfa UTSW 17 46031466 missense probably benign
R4279:Vegfa UTSW 17 46031466 missense probably benign
R4654:Vegfa UTSW 17 46025250 intron probably benign
R4696:Vegfa UTSW 17 46028346 splice site probably null
R7863:Vegfa UTSW 17 46025535 missense probably damaging 1.00
R7946:Vegfa UTSW 17 46025535 missense probably damaging 1.00
X0026:Vegfa UTSW 17 46025526 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTCCGATCGGTTTGTCTC -3'
(R):5'- TCGGATTGTGGAAATCAGCAGAC -3'

Sequencing Primer
(F):5'- CGATCGGTTTGTCTCCTGCG -3'
(R):5'- TATCAAGAGCTCCAGAGAGAAGTC -3'
Posted On2019-11-26