Incidental Mutation 'R7799:Kcnh1'
ID600406
Institutional Source Beutler Lab
Gene Symbol Kcnh1
Ensembl Gene ENSMUSG00000058248
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 1
SynonymsKv10.1, Eag1, ether a go-go
Accession Numbers

Genbank: NM_010600, NM_001038607; MGI: 1341721

Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R7799 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location192190774-192510159 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 192434875 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 690 (S690P)
Ref Sequence ENSEMBL: ENSMUSP00000077563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078470] [ENSMUST00000110844] [ENSMUST00000151152]
PDB Structure
Cyclic nucleotide binding-homology domain from mouse EAG1 potassium channel [X-RAY DIFFRACTION]
Crystal structure of PAS domain from the mouse EAG1 potassium channel [X-RAY DIFFRACTION]
Structure of the eag domain-CNBHD complex of the mouse EAG1 channel [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000078470
AA Change: S690P

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000077563
Gene: ENSMUSG00000058248
AA Change: S690P

DomainStartEndE-ValueType
PAS 16 92 2.65e0 SMART
PAC 94 136 3.67e-9 SMART
Pfam:Ion_trans 217 510 2.2e-40 PFAM
Pfam:Ion_trans_2 422 504 7e-14 PFAM
cNMP 581 699 2.2e-21 SMART
low complexity region 714 726 N/A INTRINSIC
coiled coil region 928 958 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110844
AA Change: S663P

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106468
Gene: ENSMUSG00000058248
AA Change: S663P

DomainStartEndE-ValueType
PAS 16 92 2.65e0 SMART
PAC 94 136 3.67e-9 SMART
transmembrane domain 219 241 N/A INTRINSIC
Pfam:Ion_trans 252 471 3.4e-27 PFAM
Pfam:Ion_trans_2 395 477 3.7e-14 PFAM
cNMP 554 672 2.2e-21 SMART
low complexity region 687 699 N/A INTRINSIC
coiled coil region 901 931 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000151152
AA Change: S46P

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141247
Gene: ENSMUSG00000058248
AA Change: S46P

DomainStartEndE-ValueType
SCOP:d1rgs_2 1 51 3e-6 SMART
Blast:cNMP 1 55 4e-34 BLAST
PDB:4F8A|A 1 60 1e-38 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit of a voltage-gated non-inactivating delayed rectifier potassium channel. It is activated at the onset of myoblast differentiation. The gene is highly expressed in brain and in myoblasts. Overexpression of the gene may confer a growth advantage to cancer cells and favor tumor cell proliferation. Alternative splicing of this gene results in two transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit a decreased depressive-like response during tail suspension testing. Mice homozygous for a different knock-out allele exhibit longer latency to move in haloperidol-treated mice and mild hyperactivity. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,069,601 V1517A probably benign Het
Adam17 C A 12: 21,340,492 G410C probably damaging Het
Adcy3 A G 12: 4,204,762 D698G probably damaging Het
Afap1 T A 5: 35,974,398 N356K possibly damaging Het
Afm A G 5: 90,523,854 N132D probably benign Het
Bsdc1 T A 4: 129,465,348 probably null Het
C130060K24Rik G T 6: 65,456,137 A314S possibly damaging Het
Casc4 T C 2: 121,933,541 V434A probably benign Het
Ccdc47 T C 11: 106,210,317 E173G possibly damaging Het
Cit T G 5: 115,862,968 F142C probably benign Het
Cnga3 A G 1: 37,261,771 D524G probably damaging Het
Cpne8 T A 15: 90,540,247 D313V probably damaging Het
Ell3 TCTCCTC TCTC 2: 121,439,456 probably benign Het
Flrt1 C A 19: 7,095,864 L439F possibly damaging Het
Gkn1 A T 6: 87,348,181 I82N probably damaging Het
Gm14410 C A 2: 177,193,820 C217F probably damaging Het
Gm14412 G T 2: 177,315,797 H102N probably benign Het
Gm3159 A T 14: 4,397,585 probably benign Het
Gm6205 A G 5: 94,683,428 D98G possibly damaging Het
Gm6588 T G 5: 112,449,832 Y82D not run Het
Gm9733 T A 3: 15,296,663 probably null Het
Helz2 A G 2: 181,237,989 M612T probably benign Het
Iars T A 13: 49,723,018 I853N probably damaging Het
Kcna4 A C 2: 107,295,892 I324L possibly damaging Het
Kpna3 T C 14: 61,384,733 Y194C probably damaging Het
Lrrc56 T C 7: 141,209,602 S511P probably damaging Het
Ltbp1 A G 17: 75,252,356 Y280C probably damaging Het
Macf1 A G 4: 123,527,113 I116T probably benign Het
Mmp16 A T 4: 18,112,112 N496I probably damaging Het
Mon2 T C 10: 123,042,331 D229G probably benign Het
Olfr1137 G T 2: 87,711,084 T274K possibly damaging Het
Olfr1359 T A 13: 21,703,199 L66Q probably damaging Het
Olfr485 T A 7: 108,159,430 I148F probably benign Het
Olfr531 A T 7: 140,400,464 M194K probably damaging Het
Olfr593 A G 7: 103,211,979 I40V probably benign Het
Pkp1 A G 1: 135,889,957 F147L possibly damaging Het
Ppp1r3e T C 14: 54,877,215 Q30R probably damaging Het
Ppp2r5b C A 19: 6,232,598 R174L probably benign Het
Rbm15 C T 3: 107,332,143 R313H probably damaging Het
Rgs18 A G 1: 144,753,865 F219L probably damaging Het
Ryr1 T C 7: 29,003,560 probably null Het
Sirt4 T G 5: 115,479,746 I284L probably benign Het
Slc25a11 A G 11: 70,645,179 V243A probably benign Het
Syde1 A G 10: 78,589,907 I142T probably benign Het
Synj2 A G 17: 6,037,823 E1383G probably benign Het
Syt4 A T 18: 31,440,192 C423* probably null Het
Tfr2 T A 5: 137,571,724 Y131N possibly damaging Het
Tgm1 C T 14: 55,712,475 R92Q unknown Het
Thoc1 A T 18: 9,984,441 D309V probably damaging Het
Vmn2r24 C T 6: 123,780,463 H97Y probably benign Het
Wbp1 A T 6: 83,120,195 Y89* probably null Het
Wnk1 A G 6: 119,949,176 L1358P probably benign Het
Zfp14 T C 7: 30,038,943 T206A possibly damaging Het
Zfp748 T C 13: 67,541,489 T551A probably benign Het
Zfp9 A T 6: 118,464,882 V273E probably damaging Het
Other mutations in Kcnh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Kcnh1 APN 1 192418882 missense probably damaging 0.99
IGL01675:Kcnh1 APN 1 192337593 missense probably benign 0.09
IGL01726:Kcnh1 APN 1 192505856 missense possibly damaging 0.47
IGL02006:Kcnh1 APN 1 192191015 missense possibly damaging 0.75
IGL02428:Kcnh1 APN 1 192337543 nonsense probably null
IGL02447:Kcnh1 APN 1 192224916 missense possibly damaging 0.61
IGL02512:Kcnh1 APN 1 192505381 missense possibly damaging 0.64
IGL02748:Kcnh1 APN 1 192221420 missense probably damaging 1.00
IGL02879:Kcnh1 APN 1 192276915 missense probably damaging 1.00
IGL02926:Kcnh1 APN 1 192276900 missense probably damaging 1.00
IGL03058:Kcnh1 APN 1 192434891 missense probably damaging 1.00
IGL03078:Kcnh1 APN 1 192434800 missense probably damaging 1.00
IGL03148:Kcnh1 APN 1 192276999 missense probably damaging 0.99
3-1:Kcnh1 UTSW 1 192337687 nonsense probably null
PIT4449001:Kcnh1 UTSW 1 192418684 missense probably damaging 1.00
R0226:Kcnh1 UTSW 1 192276804 nonsense probably null
R0226:Kcnh1 UTSW 1 192276805 missense probably damaging 1.00
R0240:Kcnh1 UTSW 1 192505340 missense probably benign
R0240:Kcnh1 UTSW 1 192505340 missense probably benign
R0422:Kcnh1 UTSW 1 192337580 missense probably benign
R0510:Kcnh1 UTSW 1 192418941 splice site probably benign
R0612:Kcnh1 UTSW 1 192277053 missense probably damaging 1.00
R0667:Kcnh1 UTSW 1 192506038 missense probably benign 0.00
R0838:Kcnh1 UTSW 1 192413206 missense probably damaging 0.99
R1303:Kcnh1 UTSW 1 192276702 missense probably damaging 1.00
R1389:Kcnh1 UTSW 1 192505763 missense probably benign 0.00
R1826:Kcnh1 UTSW 1 192413068 missense possibly damaging 0.64
R1997:Kcnh1 UTSW 1 192276935 missense probably damaging 0.99
R2254:Kcnh1 UTSW 1 192505414 intron probably null
R2274:Kcnh1 UTSW 1 192337521 missense probably damaging 1.00
R2275:Kcnh1 UTSW 1 192337521 missense probably damaging 1.00
R3029:Kcnh1 UTSW 1 192506060 missense probably benign 0.00
R3427:Kcnh1 UTSW 1 192241930 missense probably benign 0.06
R3552:Kcnh1 UTSW 1 192238766 missense probably damaging 1.00
R3718:Kcnh1 UTSW 1 192238799 missense probably damaging 1.00
R3760:Kcnh1 UTSW 1 192506024 missense probably damaging 1.00
R4009:Kcnh1 UTSW 1 192277140 missense probably benign
R4027:Kcnh1 UTSW 1 192276699 missense probably benign 0.05
R4453:Kcnh1 UTSW 1 192505517 missense probably damaging 0.97
R4717:Kcnh1 UTSW 1 192276717 missense probably damaging 0.99
R5014:Kcnh1 UTSW 1 192277080 missense probably damaging 0.99
R5040:Kcnh1 UTSW 1 192505475 missense probably benign 0.00
R5110:Kcnh1 UTSW 1 192337747 missense possibly damaging 0.95
R5190:Kcnh1 UTSW 1 192505528 missense probably benign 0.00
R5244:Kcnh1 UTSW 1 192224876 missense probably benign 0.23
R5383:Kcnh1 UTSW 1 192505691 missense probably benign 0.03
R5926:Kcnh1 UTSW 1 192413077 missense probably benign 0.01
R6182:Kcnh1 UTSW 1 192191053 missense probably damaging 0.97
R6516:Kcnh1 UTSW 1 192418781 missense possibly damaging 0.50
R6567:Kcnh1 UTSW 1 192277104 missense probably benign
R6655:Kcnh1 UTSW 1 192413083 missense possibly damaging 0.89
R6715:Kcnh1 UTSW 1 192337641 missense probably benign 0.00
R6823:Kcnh1 UTSW 1 192505289 makesense probably null
R6972:Kcnh1 UTSW 1 192276836 missense probably damaging 1.00
R7199:Kcnh1 UTSW 1 192337605 missense probably benign 0.01
R7219:Kcnh1 UTSW 1 192505637 missense probably benign
R7749:Kcnh1 UTSW 1 192277139 missense probably benign
R7862:Kcnh1 UTSW 1 192190859 start gained probably benign
R7945:Kcnh1 UTSW 1 192190859 start gained probably benign
R8068:Kcnh1 UTSW 1 192241942 missense probably benign 0.00
Z1176:Kcnh1 UTSW 1 192418737 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACAACTCTCTTTCCTCAGGG -3'
(R):5'- GACCAACAGACTTGCTTTCCTC -3'

Sequencing Primer
(F):5'- CTCAGGGAAAGGAGACGTGTTTG -3'
(R):5'- CTCTAACAAAGCAAGGAATTGGC -3'
Posted On2019-11-26