Incidental Mutation 'R7799:1110002E22Rik'
ID 600416
Institutional Source Beutler Lab
Gene Symbol 1110002E22Rik
Ensembl Gene ENSMUSG00000090066
Gene Name RIKEN cDNA 1110002E22 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.401) question?
Stock # R7799 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 138065052-138081506 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 138069601 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1517 (V1517A)
Ref Sequence ENSEMBL: ENSMUSP00000123851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053318] [ENSMUST00000163080]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000053318
Predicted Effect probably benign
Transcript: ENSMUST00000163080
AA Change: V1517A

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000123851
Gene: ENSMUSG00000090066
AA Change: V1517A

DomainStartEndE-ValueType
low complexity region 44 55 N/A INTRINSIC
low complexity region 87 102 N/A INTRINSIC
low complexity region 229 247 N/A INTRINSIC
low complexity region 422 438 N/A INTRINSIC
low complexity region 459 505 N/A INTRINSIC
low complexity region 667 680 N/A INTRINSIC
low complexity region 937 948 N/A INTRINSIC
low complexity region 995 1007 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
low complexity region 1224 1242 N/A INTRINSIC
low complexity region 1376 1385 N/A INTRINSIC
Pfam:DUF4585 1598 1667 6.9e-32 PFAM
low complexity region 1723 1738 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam17 C A 12: 21,340,492 G410C probably damaging Het
Adcy3 A G 12: 4,204,762 D698G probably damaging Het
Afap1 T A 5: 35,974,398 N356K possibly damaging Het
Afm A G 5: 90,523,854 N132D probably benign Het
Bsdc1 T A 4: 129,465,348 probably null Het
C130060K24Rik G T 6: 65,456,137 A314S possibly damaging Het
Casc4 T C 2: 121,933,541 V434A probably benign Het
Ccdc47 T C 11: 106,210,317 E173G possibly damaging Het
Cit T G 5: 115,862,968 F142C probably benign Het
Cnga3 A G 1: 37,261,771 D524G probably damaging Het
Cpne8 T A 15: 90,540,247 D313V probably damaging Het
Ell3 TCTCCTC TCTC 2: 121,439,456 probably benign Het
Flrt1 C A 19: 7,095,864 L439F possibly damaging Het
Gkn1 A T 6: 87,348,181 I82N probably damaging Het
Gm14410 C A 2: 177,193,820 C217F probably damaging Het
Gm14412 G T 2: 177,315,797 H102N probably benign Het
Gm3159 A T 14: 4,397,585 probably benign Het
Gm6205 A G 5: 94,683,428 D98G possibly damaging Het
Gm6588 T G 5: 112,449,832 Y82D not run Het
Gm9733 T A 3: 15,296,663 probably null Het
Helz2 A G 2: 181,237,989 M612T probably benign Het
Iars T A 13: 49,723,018 I853N probably damaging Het
Kcna4 A C 2: 107,295,892 I324L possibly damaging Het
Kcnh1 T C 1: 192,434,875 S690P probably damaging Het
Kpna3 T C 14: 61,384,733 Y194C probably damaging Het
Lrrc56 T C 7: 141,209,602 S511P probably damaging Het
Ltbp1 A G 17: 75,252,356 Y280C probably damaging Het
Macf1 A G 4: 123,527,113 I116T probably benign Het
Mmp16 A T 4: 18,112,112 N496I probably damaging Het
Mon2 T C 10: 123,042,331 D229G probably benign Het
Olfr1137 G T 2: 87,711,084 T274K possibly damaging Het
Olfr1359 T A 13: 21,703,199 L66Q probably damaging Het
Olfr485 T A 7: 108,159,430 I148F probably benign Het
Olfr531 A T 7: 140,400,464 M194K probably damaging Het
Olfr593 A G 7: 103,211,979 I40V probably benign Het
Pkp1 A G 1: 135,889,957 F147L possibly damaging Het
Ppp1r3e T C 14: 54,877,215 Q30R probably damaging Het
Ppp2r5b C A 19: 6,232,598 R174L probably benign Het
Rbm15 C T 3: 107,332,143 R313H probably damaging Het
Rgs18 A G 1: 144,753,865 F219L probably damaging Het
Ryr1 T C 7: 29,003,560 probably null Het
Sirt4 T G 5: 115,479,746 I284L probably benign Het
Slc25a11 A G 11: 70,645,179 V243A probably benign Het
Syde1 A G 10: 78,589,907 I142T probably benign Het
Synj2 A G 17: 6,037,823 E1383G probably benign Het
Syt4 A T 18: 31,440,192 C423* probably null Het
Tfr2 T A 5: 137,571,724 Y131N possibly damaging Het
Tgm1 C T 14: 55,712,475 R92Q unknown Het
Thoc1 A T 18: 9,984,441 D309V probably damaging Het
Vmn2r24 C T 6: 123,780,463 H97Y probably benign Het
Wbp1 A T 6: 83,120,195 Y89* probably null Het
Wnk1 A G 6: 119,949,176 L1358P probably benign Het
Zfp14 T C 7: 30,038,943 T206A possibly damaging Het
Zfp748 T C 13: 67,541,489 T551A probably benign Het
Zfp9 A T 6: 118,464,882 V273E probably damaging Het
Other mutations in 1110002E22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0026:1110002E22Rik UTSW 3 138066805 missense possibly damaging 0.95
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0197:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0239:1110002E22Rik UTSW 3 138065834 small deletion probably benign
R0394:1110002E22Rik UTSW 3 138067304 missense probably damaging 0.99
R0401:1110002E22Rik UTSW 3 138070306 missense possibly damaging 0.73
R0496:1110002E22Rik UTSW 3 138068244 missense probably damaging 1.00
R0591:1110002E22Rik UTSW 3 138068943 nonsense probably null
R0711:1110002E22Rik UTSW 3 138068225 missense probably damaging 0.99
R0883:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0908:1110002E22Rik UTSW 3 138070077 missense probably damaging 0.99
R0968:1110002E22Rik UTSW 3 138067206 missense probably damaging 0.99
R1023:1110002E22Rik UTSW 3 138066871 missense probably damaging 1.00
R1168:1110002E22Rik UTSW 3 138067900 missense probably benign 0.20
R1472:1110002E22Rik UTSW 3 138067552 missense possibly damaging 0.95
R1538:1110002E22Rik UTSW 3 138065401 missense probably benign 0.02
R1648:1110002E22Rik UTSW 3 138069420 missense probably benign 0.18
R1800:1110002E22Rik UTSW 3 138066718 missense probably damaging 1.00
R1919:1110002E22Rik UTSW 3 138067270 missense probably damaging 0.99
R1974:1110002E22Rik UTSW 3 138067267 missense probably damaging 1.00
R1990:1110002E22Rik UTSW 3 138065658 nonsense probably null
R1991:1110002E22Rik UTSW 3 138065658 nonsense probably null
R2102:1110002E22Rik UTSW 3 138065173 missense probably damaging 0.99
R2761:1110002E22Rik UTSW 3 138067780 missense probably damaging 0.99
R2899:1110002E22Rik UTSW 3 138065682 missense probably benign 0.00
R3618:1110002E22Rik UTSW 3 138068407 missense probably damaging 1.00
R3904:1110002E22Rik UTSW 3 138066639 missense probably benign 0.15
R3955:1110002E22Rik UTSW 3 138068073 missense probably benign 0.00
R4520:1110002E22Rik UTSW 3 138070266 missense probably damaging 0.99
R4619:1110002E22Rik UTSW 3 138069759 missense probably damaging 0.99
R4736:1110002E22Rik UTSW 3 138068485 missense probably damaging 0.99
R4752:1110002E22Rik UTSW 3 138069990 missense possibly damaging 0.91
R4777:1110002E22Rik UTSW 3 138065742 missense probably benign 0.09
R4780:1110002E22Rik UTSW 3 138065370 missense probably benign 0.02
R4824:1110002E22Rik UTSW 3 138065676 missense probably benign 0.00
R4829:1110002E22Rik UTSW 3 138069019 missense probably damaging 0.99
R4965:1110002E22Rik UTSW 3 138069672 missense probably benign
R5206:1110002E22Rik UTSW 3 138066511 missense probably benign 0.00
R5212:1110002E22Rik UTSW 3 138065850 missense possibly damaging 0.85
R5373:1110002E22Rik UTSW 3 138067635 missense probably benign
R5374:1110002E22Rik UTSW 3 138067635 missense probably benign
R5506:1110002E22Rik UTSW 3 138067947 missense probably damaging 1.00
R5528:1110002E22Rik UTSW 3 138066499 missense probably benign
R5536:1110002E22Rik UTSW 3 138066388 missense possibly damaging 0.89
R5587:1110002E22Rik UTSW 3 138065409 missense probably benign
R5759:1110002E22Rik UTSW 3 138068658 missense probably benign
R5933:1110002E22Rik UTSW 3 138070348 missense probably damaging 1.00
R5957:1110002E22Rik UTSW 3 138070161 missense probably benign
R6092:1110002E22Rik UTSW 3 138068940 missense probably benign 0.02
R6305:1110002E22Rik UTSW 3 138067980 missense probably damaging 1.00
R6457:1110002E22Rik UTSW 3 138066622 missense probably damaging 1.00
R6469:1110002E22Rik UTSW 3 138066975 missense probably damaging 0.97
R6499:1110002E22Rik UTSW 3 138068800 missense probably damaging 1.00
R6527:1110002E22Rik UTSW 3 138067527 missense probably damaging 0.99
R6580:1110002E22Rik UTSW 3 138066625 missense probably benign 0.00
R6693:1110002E22Rik UTSW 3 138069154 missense probably benign 0.00
R6751:1110002E22Rik UTSW 3 138066210 missense probably damaging 1.00
R6852:1110002E22Rik UTSW 3 138065169 nonsense probably null
R6920:1110002E22Rik UTSW 3 138068050 missense probably damaging 1.00
R7001:1110002E22Rik UTSW 3 138065511 missense probably benign
R7145:1110002E22Rik UTSW 3 138070059 missense probably damaging 1.00
R7238:1110002E22Rik UTSW 3 138069951 missense probably damaging 1.00
R7278:1110002E22Rik UTSW 3 138065476 missense probably benign
R7425:1110002E22Rik UTSW 3 138065695 missense probably benign 0.00
R7487:1110002E22Rik UTSW 3 138066868 missense probably damaging 1.00
R7557:1110002E22Rik UTSW 3 138068283 nonsense probably null
R7663:1110002E22Rik UTSW 3 138066126 missense probably damaging 0.98
R7743:1110002E22Rik UTSW 3 138068755 missense probably damaging 1.00
R8181:1110002E22Rik UTSW 3 138068395 missense probably damaging 0.99
R8264:1110002E22Rik UTSW 3 138067782 missense probably damaging 0.99
R8273:1110002E22Rik UTSW 3 138066450 missense probably benign
R8434:1110002E22Rik UTSW 3 138067260 missense probably damaging 0.97
R8530:1110002E22Rik UTSW 3 138068825 missense probably damaging 0.99
R8754:1110002E22Rik UTSW 3 138066037 missense probably benign
R8808:1110002E22Rik UTSW 3 138070113 missense probably benign 0.01
R8891:1110002E22Rik UTSW 3 138066759 nonsense probably null
R9026:1110002E22Rik UTSW 3 138065148 missense possibly damaging 0.53
R9177:1110002E22Rik UTSW 3 138069916 missense probably damaging 1.00
R9250:1110002E22Rik UTSW 3 138066628 missense probably damaging 1.00
R9291:1110002E22Rik UTSW 3 138066703 missense probably benign 0.02
R9293:1110002E22Rik UTSW 3 138066078 missense possibly damaging 0.93
R9307:1110002E22Rik UTSW 3 138065422 missense probably benign 0.04
R9439:1110002E22Rik UTSW 3 138066287 missense probably benign 0.00
X0003:1110002E22Rik UTSW 3 138069096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGAGAATTACCTGACTATCCCC -3'
(R):5'- GTCACATCCAGGAGCATCTTG -3'

Sequencing Primer
(F):5'- TATCCCCCTTAAAGGAAGTGCTG -3'
(R):5'- TCTGTGGGGACAGCAGCTG -3'
Posted On 2019-11-26