Incidental Mutation 'R7799:Tfr2'
ID600426
Institutional Source Beutler Lab
Gene Symbol Tfr2
Ensembl Gene ENSMUSG00000029716
Gene Nametransferrin receptor 2
SynonymsTrfr2, Tfr2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7799 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location137569840-137587481 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 137571724 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 131 (Y131N)
Ref Sequence ENSEMBL: ENSMUSP00000031729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031725] [ENSMUST00000031729] [ENSMUST00000139395] [ENSMUST00000196471] [ENSMUST00000198783] [ENSMUST00000198866] [ENSMUST00000199054]
Predicted Effect probably benign
Transcript: ENSMUST00000031725
SMART Domains Protein: ENSMUSP00000031725
Gene: ENSMUSG00000029712

DomainStartEndE-ValueType
ACTIN 11 379 4.16e-116 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000031729
AA Change: Y131N

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000031729
Gene: ENSMUSG00000029716
AA Change: Y131N

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Pfam:PA 235 326 2.2e-12 PFAM
Pfam:Peptidase_M28 407 618 2.9e-16 PFAM
Pfam:TFR_dimer 664 788 5.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139395
SMART Domains Protein: ENSMUSP00000119356
Gene: ENSMUSG00000029712

DomainStartEndE-ValueType
ACTIN 11 426 5.96e-167 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000196471
AA Change: Y131N

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000142814
Gene: ENSMUSG00000029716
AA Change: Y131N

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Pfam:PA 231 328 1.3e-12 PFAM
Pfam:Peptidase_M28 418 606 7.5e-15 PFAM
low complexity region 612 625 N/A INTRINSIC
Pfam:TFR_dimer 663 790 1.8e-33 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000198783
AA Change: Y131N

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000142502
Gene: ENSMUSG00000029716
AA Change: Y131N

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Pfam:PA 231 328 1.3e-12 PFAM
Pfam:Peptidase_M28 418 606 7.5e-15 PFAM
low complexity region 612 625 N/A INTRINSIC
Pfam:TFR_dimer 663 790 1.8e-33 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000198866
AA Change: Y131N

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000142720
Gene: ENSMUSG00000029716
AA Change: Y131N

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Pfam:PA 231 328 1.3e-12 PFAM
Pfam:Peptidase_M28 418 606 7.5e-15 PFAM
low complexity region 612 625 N/A INTRINSIC
Pfam:TFR_dimer 663 790 1.8e-33 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000199054
AA Change: Y131N

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000142478
Gene: ENSMUSG00000029716
AA Change: Y131N

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Pfam:PA 231 328 1.3e-12 PFAM
Pfam:Peptidase_M28 418 606 7.5e-15 PFAM
low complexity region 612 625 N/A INTRINSIC
Pfam:TFR_dimer 663 790 1.8e-33 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type II membrane protein, which is a member of the transferrin receptor-like family. This protein mediates cellular uptake of transferrin-bound iron, and may be involved in iron metabolism, hepatocyte function and erythrocyte differentiation. Mutations in this gene have been associated with hereditary hemochromatosis type III. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Homozygous mutant mice exhibit iron homeostasis defects similar to those observed in human hemachromatosis. On a standard diet, mutant mice show periportal hepatic iron loading, splenic iron sparing, and elevated serum transferrin saturations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,069,601 V1517A probably benign Het
Adam17 C A 12: 21,340,492 G410C probably damaging Het
Adcy3 A G 12: 4,204,762 D698G probably damaging Het
Afap1 T A 5: 35,974,398 N356K possibly damaging Het
Afm A G 5: 90,523,854 N132D probably benign Het
Bsdc1 T A 4: 129,465,348 probably null Het
C130060K24Rik G T 6: 65,456,137 A314S possibly damaging Het
Casc4 T C 2: 121,933,541 V434A probably benign Het
Ccdc47 T C 11: 106,210,317 E173G possibly damaging Het
Cit T G 5: 115,862,968 F142C probably benign Het
Cnga3 A G 1: 37,261,771 D524G probably damaging Het
Cpne8 T A 15: 90,540,247 D313V probably damaging Het
Ell3 TCTCCTC TCTC 2: 121,439,456 probably benign Het
Flrt1 C A 19: 7,095,864 L439F possibly damaging Het
Gkn1 A T 6: 87,348,181 I82N probably damaging Het
Gm14410 C A 2: 177,193,820 C217F probably damaging Het
Gm14412 G T 2: 177,315,797 H102N probably benign Het
Gm3159 A T 14: 4,397,585 probably benign Het
Gm6205 A G 5: 94,683,428 D98G possibly damaging Het
Gm6588 T G 5: 112,449,832 Y82D not run Het
Gm9733 T A 3: 15,296,663 probably null Het
Helz2 A G 2: 181,237,989 M612T probably benign Het
Iars T A 13: 49,723,018 I853N probably damaging Het
Kcna4 A C 2: 107,295,892 I324L possibly damaging Het
Kcnh1 T C 1: 192,434,875 S690P probably damaging Het
Kpna3 T C 14: 61,384,733 Y194C probably damaging Het
Lrrc56 T C 7: 141,209,602 S511P probably damaging Het
Ltbp1 A G 17: 75,252,356 Y280C probably damaging Het
Macf1 A G 4: 123,527,113 I116T probably benign Het
Mmp16 A T 4: 18,112,112 N496I probably damaging Het
Mon2 T C 10: 123,042,331 D229G probably benign Het
Olfr1137 G T 2: 87,711,084 T274K possibly damaging Het
Olfr1359 T A 13: 21,703,199 L66Q probably damaging Het
Olfr485 T A 7: 108,159,430 I148F probably benign Het
Olfr531 A T 7: 140,400,464 M194K probably damaging Het
Olfr593 A G 7: 103,211,979 I40V probably benign Het
Pkp1 A G 1: 135,889,957 F147L possibly damaging Het
Ppp1r3e T C 14: 54,877,215 Q30R probably damaging Het
Ppp2r5b C A 19: 6,232,598 R174L probably benign Het
Rbm15 C T 3: 107,332,143 R313H probably damaging Het
Rgs18 A G 1: 144,753,865 F219L probably damaging Het
Sirt4 T G 5: 115,479,746 I284L probably benign Het
Slc25a11 A G 11: 70,645,179 V243A probably benign Het
Syde1 A G 10: 78,589,907 I142T probably benign Het
Synj2 A G 17: 6,037,823 E1383G probably benign Het
Syt4 A T 18: 31,440,192 C423* probably null Het
Tgm1 C T 14: 55,712,475 R92Q unknown Het
Thoc1 A T 18: 9,984,441 D309V probably damaging Het
Vmn2r24 C T 6: 123,780,463 H97Y probably benign Het
Wbp1 A T 6: 83,120,195 Y89* probably null Het
Wnk1 A G 6: 119,949,176 L1358P probably benign Het
Zfp14 T C 7: 30,038,943 T206A possibly damaging Het
Zfp748 T C 13: 67,541,489 T551A probably benign Het
Zfp9 A T 6: 118,464,882 V273E probably damaging Het
Other mutations in Tfr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Tfr2 APN 5 137574455 missense probably null
IGL00960:Tfr2 APN 5 137571692 missense probably benign 0.00
IGL01360:Tfr2 APN 5 137571691 missense probably benign
IGL02967:Tfr2 APN 5 137582819 nonsense probably null
IGL02996:Tfr2 APN 5 137583466 missense probably benign
IGL03278:Tfr2 APN 5 137571036 nonsense probably null
iron-man UTSW 5 137583153 splice site probably benign
R0114:Tfr2 UTSW 5 137577465 missense probably benign 0.00
R1384:Tfr2 UTSW 5 137586820 splice site probably benign
R1525:Tfr2 UTSW 5 137579030 missense probably benign 0.00
R1545:Tfr2 UTSW 5 137583299 missense probably benign 0.03
R1765:Tfr2 UTSW 5 137583445 missense probably damaging 0.98
R1908:Tfr2 UTSW 5 137571692 missense probably benign 0.00
R1943:Tfr2 UTSW 5 137578921 missense probably benign
R3439:Tfr2 UTSW 5 137574651 missense probably benign 0.03
R4332:Tfr2 UTSW 5 137571734 missense probably damaging 1.00
R4626:Tfr2 UTSW 5 137571692 missense probably benign 0.00
R4915:Tfr2 UTSW 5 137583411 missense probably damaging 0.96
R4999:Tfr2 UTSW 5 137586925 missense probably benign 0.00
R5150:Tfr2 UTSW 5 137574490 missense probably benign 0.22
R5200:Tfr2 UTSW 5 137570980 splice site probably benign
R5936:Tfr2 UTSW 5 137587006 missense probably benign 0.00
R6165:Tfr2 UTSW 5 137580257 missense probably damaging 0.97
R6513:Tfr2 UTSW 5 137574531 splice site probably null
R7076:Tfr2 UTSW 5 137583574 missense probably damaging 1.00
R7115:Tfr2 UTSW 5 137571715 missense probably benign
R7524:Tfr2 UTSW 5 137571489 nonsense probably null
R7524:Tfr2 UTSW 5 137583489 missense probably benign 0.12
X0067:Tfr2 UTSW 5 137577548 missense probably benign 0.01
Z1176:Tfr2 UTSW 5 137571737 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCCTGATCACCCTGCTAATC -3'
(R):5'- GACCCAAGAAAGGACTTTGGGC -3'

Sequencing Primer
(F):5'- CCTGCTAATCTTCACTGGGGG -3'
(R):5'- GGACTTTGGGCAACACGTG -3'
Posted On2019-11-26