Incidental Mutation 'R7799:Olfr1359'
ID600444
Institutional Source Beutler Lab
Gene Symbol Olfr1359
Ensembl Gene ENSMUSG00000108674
Gene Nameolfactory receptor 1359
SynonymsMOR256-60, MOR256-35, GA_x6K02T2QHY8-11534186-11533245
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R7799 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location21698111-21706833 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21703199 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 66 (L66Q)
Ref Sequence ENSEMBL: ENSMUSP00000150106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077843] [ENSMUST00000214435]
Predicted Effect probably damaging
Transcript: ENSMUST00000077843
AA Change: L66Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077010
Gene: ENSMUSG00000108674
AA Change: L66Q

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2e-55 PFAM
Pfam:7tm_1 41 290 1.7e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214435
AA Change: L66Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,069,601 V1517A probably benign Het
Adam17 C A 12: 21,340,492 G410C probably damaging Het
Adcy3 A G 12: 4,204,762 D698G probably damaging Het
Afap1 T A 5: 35,974,398 N356K possibly damaging Het
Afm A G 5: 90,523,854 N132D probably benign Het
Bsdc1 T A 4: 129,465,348 probably null Het
C130060K24Rik G T 6: 65,456,137 A314S possibly damaging Het
Casc4 T C 2: 121,933,541 V434A probably benign Het
Ccdc47 T C 11: 106,210,317 E173G possibly damaging Het
Cit T G 5: 115,862,968 F142C probably benign Het
Cnga3 A G 1: 37,261,771 D524G probably damaging Het
Cpne8 T A 15: 90,540,247 D313V probably damaging Het
Ell3 TCTCCTC TCTC 2: 121,439,456 probably benign Het
Flrt1 C A 19: 7,095,864 L439F possibly damaging Het
Gkn1 A T 6: 87,348,181 I82N probably damaging Het
Gm14410 C A 2: 177,193,820 C217F probably damaging Het
Gm14412 G T 2: 177,315,797 H102N probably benign Het
Gm3159 A T 14: 4,397,585 probably benign Het
Gm6205 A G 5: 94,683,428 D98G possibly damaging Het
Gm6588 T G 5: 112,449,832 Y82D not run Het
Gm9733 T A 3: 15,296,663 probably null Het
Helz2 A G 2: 181,237,989 M612T probably benign Het
Iars T A 13: 49,723,018 I853N probably damaging Het
Kcna4 A C 2: 107,295,892 I324L possibly damaging Het
Kcnh1 T C 1: 192,434,875 S690P probably damaging Het
Kpna3 T C 14: 61,384,733 Y194C probably damaging Het
Lrrc56 T C 7: 141,209,602 S511P probably damaging Het
Ltbp1 A G 17: 75,252,356 Y280C probably damaging Het
Macf1 A G 4: 123,527,113 I116T probably benign Het
Mmp16 A T 4: 18,112,112 N496I probably damaging Het
Mon2 T C 10: 123,042,331 D229G probably benign Het
Olfr1137 G T 2: 87,711,084 T274K possibly damaging Het
Olfr485 T A 7: 108,159,430 I148F probably benign Het
Olfr531 A T 7: 140,400,464 M194K probably damaging Het
Olfr593 A G 7: 103,211,979 I40V probably benign Het
Pkp1 A G 1: 135,889,957 F147L possibly damaging Het
Ppp1r3e T C 14: 54,877,215 Q30R probably damaging Het
Ppp2r5b C A 19: 6,232,598 R174L probably benign Het
Rbm15 C T 3: 107,332,143 R313H probably damaging Het
Rgs18 A G 1: 144,753,865 F219L probably damaging Het
Sirt4 T G 5: 115,479,746 I284L probably benign Het
Slc25a11 A G 11: 70,645,179 V243A probably benign Het
Syde1 A G 10: 78,589,907 I142T probably benign Het
Synj2 A G 17: 6,037,823 E1383G probably benign Het
Syt4 A T 18: 31,440,192 C423* probably null Het
Tfr2 T A 5: 137,571,724 Y131N possibly damaging Het
Tgm1 C T 14: 55,712,475 R92Q unknown Het
Thoc1 A T 18: 9,984,441 D309V probably damaging Het
Vmn2r24 C T 6: 123,780,463 H97Y probably benign Het
Wbp1 A T 6: 83,120,195 Y89* probably null Het
Wnk1 A G 6: 119,949,176 L1358P probably benign Het
Zfp14 T C 7: 30,038,943 T206A possibly damaging Het
Zfp748 T C 13: 67,541,489 T551A probably benign Het
Zfp9 A T 6: 118,464,882 V273E probably damaging Het
Other mutations in Olfr1359
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01563:Olfr1359 APN 13 21703073 missense probably benign 0.21
R1601:Olfr1359 UTSW 13 21703226 missense probably damaging 1.00
R1743:Olfr1359 UTSW 13 21703450 missense probably benign 0.00
R1944:Olfr1359 UTSW 13 21703117 missense possibly damaging 0.95
R4084:Olfr1359 UTSW 13 21703069 missense probably damaging 1.00
R4084:Olfr1359 UTSW 13 21703068 nonsense probably null
R5677:Olfr1359 UTSW 13 21703223 missense probably benign 0.03
R6485:Olfr1359 UTSW 13 21703430 missense probably benign 0.00
R6981:Olfr1359 UTSW 13 21703073 missense probably benign 0.21
R7028:Olfr1359 UTSW 13 21703270 missense possibly damaging 0.95
R7221:Olfr1359 UTSW 13 21703102 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTGTACCGTTTAATATGAGTG -3'
(R):5'- GCCGACAGATGGCTACAAAC -3'

Sequencing Primer
(F):5'- TGTGGCCAATGAGAGCATCTC -3'
(R):5'- GACAGATGGCTACAAACCTGTC -3'
Posted On2019-11-26