Incidental Mutation 'R7800:Crisp4'
ID600458
Institutional Source Beutler Lab
Gene Symbol Crisp4
Ensembl Gene ENSMUSG00000025774
Gene Namecysteine-rich secretory protein 4
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7800 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location18115191-18145902 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 18128749 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 154 (S154A)
Ref Sequence ENSEMBL: ENSMUSP00000111001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026876] [ENSMUST00000115340] [ENSMUST00000115344]
Predicted Effect probably benign
Transcript: ENSMUST00000026876
AA Change: S115A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000026876
Gene: ENSMUSG00000025774
AA Change: S115A

DomainStartEndE-ValueType
transmembrane domain 7 24 N/A INTRINSIC
SCP 44 188 1.32e-45 SMART
Pfam:Crisp 200 254 4.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115340
AA Change: S111A

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000110997
Gene: ENSMUSG00000025774
AA Change: S111A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SCP 40 184 1.32e-45 SMART
Pfam:Crisp 196 250 6.2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115344
AA Change: S154A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000111001
Gene: ENSMUSG00000025774
AA Change: S154A

DomainStartEndE-ValueType
transmembrane domain 39 61 N/A INTRINSIC
SCP 83 227 1.32e-45 SMART
Pfam:Crisp 239 293 1.6e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Fertilization consists of a sequence of specific cell-cell interactions culminating in the fusion of the sperm and egg plasma membranes. Recognition, binding, and fusion occur through the interaction of complementary molecules that are localized to specific domains of the sperm and egg plasma membranes. In the sperm, the postacrosomal region or equatorial segment is involved in sperm-egg plasma membrane fusion. The protein encoded by this gene is a member of the cysteine-rich secretory protein (CRISP) family. It is expressed in the epididymis, is secreted into the epididymal lumen, and binds to the postacrosomal region of the sperm head, where it plays a role in sperm-egg fusion. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a null mutation display an impaired acrosome reaction in response to progesterone but are fertile with normal testis morphology and weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,187,872 D1264G probably benign Het
Ace T C 11: 105,986,058 F1122S probably damaging Het
Actr10 T G 12: 70,943,509 Y112D probably benign Het
Cacnb1 T G 11: 98,009,295 I346L possibly damaging Het
Camsap2 T C 1: 136,281,901 T607A probably damaging Het
Cby3 T C 11: 50,359,348 F32S probably damaging Het
Cers5 G T 15: 99,736,241 H409N probably benign Het
Ces1h A T 8: 93,379,694 L11H Het
Clcnkb T C 4: 141,414,522 Y51C probably benign Het
Cnnm2 A G 19: 46,877,981 E856G probably benign Het
Cnot1 A G 8: 95,765,062 V378A probably benign Het
Ddx58 T C 4: 40,211,618 E650G probably benign Het
Disp1 C T 1: 183,098,986 R241Q probably benign Het
Ermard G A 17: 15,056,803 R429H probably benign Het
Extl1 C T 4: 134,371,618 G34D probably benign Het
Gen1 T C 12: 11,241,862 D707G probably benign Het
Hist1h1d C A 13: 23,555,367 T93N possibly damaging Het
Igkv5-37 A C 6: 69,963,515 S48R possibly damaging Het
Ilvbl C T 10: 78,583,975 A571V possibly damaging Het
Itgb1 A G 8: 128,713,237 K136E possibly damaging Het
Lhx8 A G 3: 154,321,647 F253L probably damaging Het
Naa25 A G 5: 121,424,531 T459A possibly damaging Het
Nr3c2 A G 8: 76,909,992 Y574C probably damaging Het
Nrxn1 C T 17: 91,089,207 probably benign Het
Ntrk3 T A 7: 78,302,740 R576S probably benign Het
Nup210l A G 3: 90,134,597 Y403C probably damaging Het
Olfr693 A G 7: 106,677,574 V304A probably benign Het
Olfr920 T G 9: 38,756,618 L310W probably damaging Het
Otogl T A 10: 107,886,515 Y326F probably damaging Het
Pcdha1 T A 18: 36,931,373 D363E probably damaging Het
Pcdhb3 T A 18: 37,301,921 N313K probably benign Het
Pcdhb9 A C 18: 37,401,549 S199R probably benign Het
Pde4dip C T 3: 97,715,283 D1537N probably damaging Het
Pinx1 A G 14: 63,919,535 K304E probably benign Het
Pnlip T C 19: 58,681,702 V458A probably benign Het
Polr3a C A 14: 24,484,387 M60I probably null Het
Qrich2 G T 11: 116,456,860 S1046* probably null Het
Rps6ka5 G A 12: 100,558,565 P638S probably damaging Het
Slc6a13 T A 6: 121,321,699 N158K probably damaging Het
Sord T C 2: 122,259,080 V187A probably damaging Het
Sult2a2 A G 7: 13,734,785 T59A probably benign Het
Thbs2 T C 17: 14,676,296 D777G probably damaging Het
Tmed9 A G 13: 55,595,532 D159G probably benign Het
Trbc1 A G 6: 41,539,261 I142V Het
Usp17ld A G 7: 103,250,834 V297A probably damaging Het
Vmn1r167 A T 7: 23,504,644 *316R probably null Het
Wdr59 C A 8: 111,521,938 R15L Het
Zfp189 C T 4: 49,529,367 P157S possibly damaging Het
Zfp407 C T 18: 84,560,675 G771D probably damaging Het
Other mutations in Crisp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00974:Crisp4 APN 1 18128647 missense probably damaging 1.00
IGL01071:Crisp4 APN 1 18137007 missense probably benign 0.41
IGL01641:Crisp4 APN 1 18124290 missense possibly damaging 0.91
IGL01670:Crisp4 APN 1 18128677 missense probably benign 0.03
IGL01985:Crisp4 APN 1 18134065 missense probably damaging 1.00
IGL02043:Crisp4 APN 1 18134100 missense probably damaging 1.00
R1241:Crisp4 UTSW 1 18122794 missense probably damaging 1.00
R1978:Crisp4 UTSW 1 18128665 missense probably benign 0.04
R5269:Crisp4 UTSW 1 18128710 missense probably damaging 1.00
R5736:Crisp4 UTSW 1 18115715 missense probably benign 0.03
R6154:Crisp4 UTSW 1 18122788 missense possibly damaging 0.80
R6999:Crisp4 UTSW 1 18137035 missense possibly damaging 0.56
R7255:Crisp4 UTSW 1 18130231 missense probably damaging 0.99
R7446:Crisp4 UTSW 1 18122738 missense probably damaging 1.00
R7831:Crisp4 UTSW 1 18128789 missense probably benign 0.29
R7881:Crisp4 UTSW 1 18128669 missense probably benign 0.07
R7914:Crisp4 UTSW 1 18128789 missense probably benign 0.29
R7964:Crisp4 UTSW 1 18128669 missense probably benign 0.07
R8053:Crisp4 UTSW 1 18124274 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TTTTCCTTAGGCCTGAGAAGAG -3'
(R):5'- TGCCAGACTTGAGCACAAC -3'

Sequencing Primer
(F):5'- TTCCTTAGGCCTGAGAAGAGAAATAG -3'
(R):5'- GAGCACAACATGATCATTCAGTG -3'
Posted On2019-11-26