Incidental Mutation 'R7800:Sord'
ID600461
Institutional Source Beutler Lab
Gene Symbol Sord
Ensembl Gene ENSMUSG00000027227
Gene Namesorbitol dehydrogenase
SynonymsSodh-1, Sdh1, Sdh-1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7800 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location122234749-122265340 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122259080 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 187 (V187A)
Ref Sequence ENSEMBL: ENSMUSP00000106180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110551]
Predicted Effect probably damaging
Transcript: ENSMUST00000110551
AA Change: V187A

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106180
Gene: ENSMUSG00000027227
AA Change: V187A

DomainStartEndE-ValueType
Pfam:ADH_N 32 143 1.3e-24 PFAM
Pfam:Glu_dehyd_C 149 349 5.1e-12 PFAM
Pfam:AlaDh_PNT_C 161 242 6e-8 PFAM
Pfam:ADH_zinc_N 183 313 3.1e-25 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sorbitol dehydrogenase (SORD; EC 1.1.1.14) catalyzes the interconversion of polyols and their corresponding ketoses, and together with aldose reductase (ALDR1; MIM 103880), makes up the sorbitol pathway that is believed to play an important role in the development of diabetic complications (summarized by Carr and Markham, 1995 [PubMed 8535074]). The first reaction of the pathway (also called the polyol pathway) is the reduction of glucose to sorbitol by ALDR1 with NADPH as the cofactor. SORD then oxidizes the sorbitol to fructose using NAD(+) cofactor.[supplied by OMIM, Jul 2010]
PHENOTYPE: Mice homozygous for a functional null allele found in strain C57BL/LiA exhibit no obvious abnormalities in the kidney or other physiological systems. An additional isoelectric focusing variant is found in Peru stocks and has about 25% of the activity of that in most inbred strains. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,187,872 D1264G probably benign Het
Ace T C 11: 105,986,058 F1122S probably damaging Het
Actr10 T G 12: 70,943,509 Y112D probably benign Het
Cacnb1 T G 11: 98,009,295 I346L possibly damaging Het
Camsap2 T C 1: 136,281,901 T607A probably damaging Het
Cby3 T C 11: 50,359,348 F32S probably damaging Het
Cers5 G T 15: 99,736,241 H409N probably benign Het
Ces1h A T 8: 93,379,694 L11H Het
Clcnkb T C 4: 141,414,522 Y51C probably benign Het
Cnnm2 A G 19: 46,877,981 E856G probably benign Het
Cnot1 A G 8: 95,765,062 V378A probably benign Het
Crisp4 A C 1: 18,128,749 S154A probably benign Het
Ddx58 T C 4: 40,211,618 E650G probably benign Het
Disp1 C T 1: 183,098,986 R241Q probably benign Het
Ermard G A 17: 15,056,803 R429H probably benign Het
Extl1 C T 4: 134,371,618 G34D probably benign Het
Gen1 T C 12: 11,241,862 D707G probably benign Het
Hist1h1d C A 13: 23,555,367 T93N possibly damaging Het
Igkv5-37 A C 6: 69,963,515 S48R possibly damaging Het
Ilvbl C T 10: 78,583,975 A571V possibly damaging Het
Itgb1 A G 8: 128,713,237 K136E possibly damaging Het
Lhx8 A G 3: 154,321,647 F253L probably damaging Het
Naa25 A G 5: 121,424,531 T459A possibly damaging Het
Nr3c2 A G 8: 76,909,992 Y574C probably damaging Het
Nrxn1 C T 17: 91,089,207 probably benign Het
Ntrk3 T A 7: 78,302,740 R576S probably benign Het
Nup210l A G 3: 90,134,597 Y403C probably damaging Het
Olfr693 A G 7: 106,677,574 V304A probably benign Het
Olfr920 T G 9: 38,756,618 L310W probably damaging Het
Otogl T A 10: 107,886,515 Y326F probably damaging Het
Pcdha1 T A 18: 36,931,373 D363E probably damaging Het
Pcdhb3 T A 18: 37,301,921 N313K probably benign Het
Pcdhb9 A C 18: 37,401,549 S199R probably benign Het
Pde4dip C T 3: 97,715,283 D1537N probably damaging Het
Pinx1 A G 14: 63,919,535 K304E probably benign Het
Pnlip T C 19: 58,681,702 V458A probably benign Het
Polr3a C A 14: 24,484,387 M60I probably null Het
Qrich2 G T 11: 116,456,860 S1046* probably null Het
Rps6ka5 G A 12: 100,558,565 P638S probably damaging Het
Slc6a13 T A 6: 121,321,699 N158K probably damaging Het
Sult2a2 A G 7: 13,734,785 T59A probably benign Het
Thbs2 T C 17: 14,676,296 D777G probably damaging Het
Tmed9 A G 13: 55,595,532 D159G probably benign Het
Trbc1 A G 6: 41,539,261 I142V Het
Usp17ld A G 7: 103,250,834 V297A probably damaging Het
Vmn1r167 A T 7: 23,504,644 *316R probably null Het
Wdr59 C A 8: 111,521,938 R15L Het
Zfp189 C T 4: 49,529,367 P157S possibly damaging Het
Zfp407 C T 18: 84,560,675 G771D probably damaging Het
Other mutations in Sord
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Sord APN 2 122264083 missense probably benign 0.28
R6015:Sord UTSW 2 122256943 missense probably damaging 1.00
R6258:Sord UTSW 2 122259132 critical splice donor site probably null
R6260:Sord UTSW 2 122259132 critical splice donor site probably null
R6417:Sord UTSW 2 122264121 missense possibly damaging 0.93
R6420:Sord UTSW 2 122264121 missense possibly damaging 0.93
R6940:Sord UTSW 2 122264055 missense probably damaging 0.99
R7903:Sord UTSW 2 122263225 missense probably benign 0.02
R7986:Sord UTSW 2 122263225 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AAATCTTAGCGTGTGCCAGG -3'
(R):5'- CTTTCTAAGCAAGAGCAGAGAAC -3'

Sequencing Primer
(F):5'- TGTGCCAGGCAATTGCATAGAC -3'
(R):5'- AATTCAAGGTCAGCCTGGTC -3'
Posted On2019-11-26