Incidental Mutation 'R7800:Nup210l'
ID600462
Institutional Source Beutler Lab
Gene Symbol Nup210l
Ensembl Gene ENSMUSG00000027939
Gene Namenucleoporin 210-like
Synonyms4930548O11Rik, R26-EGFP, Tg(Gt(ROSA)26Sor-EGFP)130910Eps
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.404) question?
Stock #R7800 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location90104132-90212048 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90134597 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 403 (Y403C)
Ref Sequence ENSEMBL: ENSMUSP00000029548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029548] [ENSMUST00000200410]
Predicted Effect probably damaging
Transcript: ENSMUST00000029548
AA Change: Y403C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029548
Gene: ENSMUSG00000027939
AA Change: Y403C

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
BID_2 457 536 2.05e1 SMART
Blast:S1 949 1023 2e-16 BLAST
BID_2 1077 1152 4.51e-11 SMART
Blast:BID_2 1468 1550 7e-15 BLAST
transmembrane domain 1807 1829 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200410
AA Change: Y403C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143368
Gene: ENSMUSG00000027939
AA Change: Y403C

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
BID_2 457 536 6.9e-2 SMART
Blast:S1 938 1023 9e-17 BLAST
BID_2 1077 1152 1.5e-13 SMART
Blast:BID_2 1468 1550 7e-15 BLAST
transmembrane domain 1807 1829 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a transgene insertion exhibit male infertility, asthenozoospermia, teratozoospermia, azoospermia, and seminiferous tubule degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,187,872 D1264G probably benign Het
Ace T C 11: 105,986,058 F1122S probably damaging Het
Actr10 T G 12: 70,943,509 Y112D probably benign Het
Cacnb1 T G 11: 98,009,295 I346L possibly damaging Het
Camsap2 T C 1: 136,281,901 T607A probably damaging Het
Cby3 T C 11: 50,359,348 F32S probably damaging Het
Cers5 G T 15: 99,736,241 H409N probably benign Het
Ces1h A T 8: 93,379,694 L11H Het
Clcnkb T C 4: 141,414,522 Y51C probably benign Het
Cnnm2 A G 19: 46,877,981 E856G probably benign Het
Cnot1 A G 8: 95,765,062 V378A probably benign Het
Crisp4 A C 1: 18,128,749 S154A probably benign Het
Ddx58 T C 4: 40,211,618 E650G probably benign Het
Disp1 C T 1: 183,098,986 R241Q probably benign Het
Ermard G A 17: 15,056,803 R429H probably benign Het
Extl1 C T 4: 134,371,618 G34D probably benign Het
Gen1 T C 12: 11,241,862 D707G probably benign Het
Hist1h1d C A 13: 23,555,367 T93N possibly damaging Het
Igkv5-37 A C 6: 69,963,515 S48R possibly damaging Het
Ilvbl C T 10: 78,583,975 A571V possibly damaging Het
Itgb1 A G 8: 128,713,237 K136E possibly damaging Het
Lhx8 A G 3: 154,321,647 F253L probably damaging Het
Naa25 A G 5: 121,424,531 T459A possibly damaging Het
Nr3c2 A G 8: 76,909,992 Y574C probably damaging Het
Nrxn1 C T 17: 91,089,207 probably benign Het
Ntrk3 T A 7: 78,302,740 R576S probably benign Het
Olfr693 A G 7: 106,677,574 V304A probably benign Het
Olfr920 T G 9: 38,756,618 L310W probably damaging Het
Otogl T A 10: 107,886,515 Y326F probably damaging Het
Pcdha1 T A 18: 36,931,373 D363E probably damaging Het
Pcdhb3 T A 18: 37,301,921 N313K probably benign Het
Pcdhb9 A C 18: 37,401,549 S199R probably benign Het
Pde4dip C T 3: 97,715,283 D1537N probably damaging Het
Pinx1 A G 14: 63,919,535 K304E probably benign Het
Pnlip T C 19: 58,681,702 V458A probably benign Het
Polr3a C A 14: 24,484,387 M60I probably null Het
Qrich2 G T 11: 116,456,860 S1046* probably null Het
Rps6ka5 G A 12: 100,558,565 P638S probably damaging Het
Slc6a13 T A 6: 121,321,699 N158K probably damaging Het
Sord T C 2: 122,259,080 V187A probably damaging Het
Sult2a2 A G 7: 13,734,785 T59A probably benign Het
Thbs2 T C 17: 14,676,296 D777G probably damaging Het
Tmed9 A G 13: 55,595,532 D159G probably benign Het
Trbc1 A G 6: 41,539,261 I142V Het
Usp17ld A G 7: 103,250,834 V297A probably damaging Het
Vmn1r167 A T 7: 23,504,644 *316R probably null Het
Wdr59 C A 8: 111,521,938 R15L Het
Zfp189 C T 4: 49,529,367 P157S possibly damaging Het
Zfp407 C T 18: 84,560,675 G771D probably damaging Het
Other mutations in Nup210l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Nup210l APN 3 90190849 splice site probably benign
IGL00813:Nup210l APN 3 90132418 missense probably benign 0.00
IGL01375:Nup210l APN 3 90159893 missense probably damaging 0.96
IGL01731:Nup210l APN 3 90154566 missense probably damaging 1.00
IGL01786:Nup210l APN 3 90122776 nonsense probably null
IGL01958:Nup210l APN 3 90203924 missense possibly damaging 0.74
IGL02094:Nup210l APN 3 90180213 critical splice donor site probably null
IGL02120:Nup210l APN 3 90136862 missense probably damaging 1.00
IGL02313:Nup210l APN 3 90122792 missense probably damaging 1.00
IGL02336:Nup210l APN 3 90181552 critical splice donor site probably null
IGL02348:Nup210l APN 3 90104164 utr 5 prime probably benign
IGL02372:Nup210l APN 3 90201971 missense possibly damaging 0.80
IGL02557:Nup210l APN 3 90124230 missense probably damaging 1.00
IGL02559:Nup210l APN 3 90159953 missense probably benign 0.02
IGL02738:Nup210l APN 3 90136850 missense possibly damaging 0.80
IGL03231:Nup210l APN 3 90189545 missense probably damaging 1.00
IGL03257:Nup210l APN 3 90180148 critical splice acceptor site probably null
IGL03388:Nup210l APN 3 90170044 missense probably damaging 1.00
IGL03134:Nup210l UTSW 3 90190887 missense possibly damaging 0.85
R0003:Nup210l UTSW 3 90119911 missense probably damaging 1.00
R0040:Nup210l UTSW 3 90181905 missense probably damaging 1.00
R0083:Nup210l UTSW 3 90189575 missense probably damaging 1.00
R0090:Nup210l UTSW 3 90211779 missense probably benign 0.00
R0108:Nup210l UTSW 3 90189575 missense probably damaging 1.00
R0142:Nup210l UTSW 3 90172113 missense probably damaging 1.00
R0306:Nup210l UTSW 3 90207368 missense probably benign 0.13
R0332:Nup210l UTSW 3 90132309 splice site probably benign
R0346:Nup210l UTSW 3 90189438 missense probably damaging 1.00
R0463:Nup210l UTSW 3 90180211 missense probably null 1.00
R0622:Nup210l UTSW 3 90167740 missense probably damaging 0.98
R0765:Nup210l UTSW 3 90119877 missense probably damaging 0.99
R0990:Nup210l UTSW 3 90211925 missense probably benign 0.00
R1014:Nup210l UTSW 3 90170048 missense possibly damaging 0.62
R1036:Nup210l UTSW 3 90192940 splice site probably benign
R1177:Nup210l UTSW 3 90202003 missense probably benign 0.11
R1183:Nup210l UTSW 3 90159945 missense probably benign 0.04
R1188:Nup210l UTSW 3 90198179 missense probably benign 0.16
R1457:Nup210l UTSW 3 90190972 missense possibly damaging 0.68
R1471:Nup210l UTSW 3 90170562 missense probably benign
R1627:Nup210l UTSW 3 90144169 missense probably benign 0.15
R1778:Nup210l UTSW 3 90189486 missense probably damaging 0.99
R1827:Nup210l UTSW 3 90154557 missense probably damaging 1.00
R1843:Nup210l UTSW 3 90172086 missense probably damaging 0.96
R1858:Nup210l UTSW 3 90154499 missense probably damaging 0.97
R1942:Nup210l UTSW 3 90151237 missense probably benign 0.01
R2015:Nup210l UTSW 3 90185432 missense probably damaging 1.00
R2113:Nup210l UTSW 3 90190974 missense possibly damaging 0.48
R2944:Nup210l UTSW 3 90181545 missense probably damaging 1.00
R3736:Nup210l UTSW 3 90120013 missense probably damaging 1.00
R3740:Nup210l UTSW 3 90207394 missense probably benign 0.08
R3741:Nup210l UTSW 3 90207394 missense probably benign 0.08
R3742:Nup210l UTSW 3 90207394 missense probably benign 0.08
R3771:Nup210l UTSW 3 90119894 nonsense probably null
R3773:Nup210l UTSW 3 90119894 nonsense probably null
R3879:Nup210l UTSW 3 90185473 missense probably damaging 1.00
R3882:Nup210l UTSW 3 90124210 missense probably benign 0.19
R3953:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R3954:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R3955:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R3956:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R4200:Nup210l UTSW 3 90119911 missense probably damaging 1.00
R4290:Nup210l UTSW 3 90207326 missense probably benign 0.00
R4328:Nup210l UTSW 3 90175835 splice site probably null
R4629:Nup210l UTSW 3 90167875 missense probably benign 0.21
R4629:Nup210l UTSW 3 90190874 nonsense probably null
R4897:Nup210l UTSW 3 90193071 missense probably damaging 1.00
R4906:Nup210l UTSW 3 90170030 missense probably benign 0.06
R4966:Nup210l UTSW 3 90106901 missense probably benign 0.00
R5004:Nup210l UTSW 3 90180165 nonsense probably null
R5237:Nup210l UTSW 3 90180198 missense probably benign 0.00
R5499:Nup210l UTSW 3 90174370 missense probably damaging 1.00
R5522:Nup210l UTSW 3 90154665 missense probably benign 0.10
R5627:Nup210l UTSW 3 90144250 missense probably damaging 0.97
R5678:Nup210l UTSW 3 90190959 missense probably damaging 0.99
R5726:Nup210l UTSW 3 90129207 intron probably null
R5792:Nup210l UTSW 3 90199857 missense probably damaging 1.00
R6129:Nup210l UTSW 3 90104176 missense probably benign 0.00
R6272:Nup210l UTSW 3 90170024 missense possibly damaging 0.57
R6290:Nup210l UTSW 3 90119909 nonsense probably null
R6293:Nup210l UTSW 3 90115064 missense probably damaging 1.00
R6446:Nup210l UTSW 3 90172068 missense probably damaging 1.00
R6698:Nup210l UTSW 3 90182508 missense possibly damaging 0.57
R6855:Nup210l UTSW 3 90136924 missense probably benign 0.01
R6895:Nup210l UTSW 3 90159924 missense probably damaging 0.97
R6899:Nup210l UTSW 3 90167897 missense possibly damaging 0.77
R6978:Nup210l UTSW 3 90154566 missense possibly damaging 0.86
R6980:Nup210l UTSW 3 90119927 missense probably benign 0.04
R7038:Nup210l UTSW 3 90159947 missense probably damaging 1.00
R7273:Nup210l UTSW 3 90118547 missense probably benign 0.04
R7450:Nup210l UTSW 3 90115188 critical splice donor site probably null
R7514:Nup210l UTSW 3 90210459 critical splice donor site probably null
R7658:Nup210l UTSW 3 90211993 missense probably benign 0.43
R7735:Nup210l UTSW 3 90185576 missense probably damaging 1.00
R7772:Nup210l UTSW 3 90159926 missense probably damaging 1.00
R7840:Nup210l UTSW 3 90122729 missense probably benign 0.08
R7847:Nup210l UTSW 3 90151123 missense probably benign
R7848:Nup210l UTSW 3 90203905 missense probably benign 0.01
R7923:Nup210l UTSW 3 90122729 missense probably benign 0.08
R7930:Nup210l UTSW 3 90151123 missense probably benign
R7931:Nup210l UTSW 3 90203905 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGAGTTGGGTCTTCTACAAGAG -3'
(R):5'- GCTTTAGATCAAGGCTGCCTG -3'

Sequencing Primer
(F):5'- AGTGCCCTTAATCACTGAGC -3'
(R):5'- CTGCCTGCCCTGCTGAG -3'
Posted On2019-11-26