Incidental Mutation 'R7800:Lhx8'
ID600464
Institutional Source Beutler Lab
Gene Symbol Lhx8
Ensembl Gene ENSMUSG00000096225
Gene NameLIM homeobox protein 8
SynonymsL3, Lhx7
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.284) question?
Stock #R7800 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location154306294-154330659 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 154321647 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 253 (F253L)
Ref Sequence ENSEMBL: ENSMUSP00000136047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177846] [ENSMUST00000204171] [ENSMUST00000204403] [ENSMUST00000205251]
Predicted Effect probably damaging
Transcript: ENSMUST00000177846
AA Change: F253L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136047
Gene: ENSMUSG00000096225
AA Change: F253L

DomainStartEndE-ValueType
low complexity region 67 87 N/A INTRINSIC
LIM 95 148 2.38e-12 SMART
LIM 156 210 2.06e-16 SMART
HOX 246 308 2.7e-23 SMART
low complexity region 310 321 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204171
SMART Domains Protein: ENSMUSP00000144708
Gene: ENSMUSG00000096225

DomainStartEndE-ValueType
low complexity region 11 31 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204403
SMART Domains Protein: ENSMUSP00000145516
Gene: ENSMUSG00000096225

DomainStartEndE-ValueType
low complexity region 36 56 N/A INTRINSIC
LIM 64 117 2.38e-12 SMART
LIM 125 179 2.06e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000205251
AA Change: F222L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145485
Gene: ENSMUSG00000096225
AA Change: F222L

DomainStartEndE-ValueType
low complexity region 36 56 N/A INTRINSIC
LIM 64 117 2.38e-12 SMART
LIM 125 179 2.06e-16 SMART
HOX 215 277 2.7e-23 SMART
low complexity region 279 290 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the LIM homeobox family of proteins, which are involved in patterning and differentiation of various tissue types. These proteins contain two tandemly repeated cysteine-rich double-zinc finger motifs known as LIM domains, in addition to a DNA-binding homeodomain. This family member is a transcription factor that plays a role in tooth morphogenesis. It is also involved in oogenesis and in neuronal differentiation. This gene is a candidate gene for cleft palate, and it is also associated with odontoma formation. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null mice exhibit partial penetrance of a cleft secondary palate and neonatal lethality; those without cleft palate survive to adulthood. All homozygous null mice have decreased or absent forebrain cholinergic neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,187,872 D1264G probably benign Het
Ace T C 11: 105,986,058 F1122S probably damaging Het
Actr10 T G 12: 70,943,509 Y112D probably benign Het
Cacnb1 T G 11: 98,009,295 I346L possibly damaging Het
Camsap2 T C 1: 136,281,901 T607A probably damaging Het
Cby3 T C 11: 50,359,348 F32S probably damaging Het
Cers5 G T 15: 99,736,241 H409N probably benign Het
Ces1h A T 8: 93,379,694 L11H Het
Clcnkb T C 4: 141,414,522 Y51C probably benign Het
Cnnm2 A G 19: 46,877,981 E856G probably benign Het
Cnot1 A G 8: 95,765,062 V378A probably benign Het
Crisp4 A C 1: 18,128,749 S154A probably benign Het
Ddx58 T C 4: 40,211,618 E650G probably benign Het
Disp1 C T 1: 183,098,986 R241Q probably benign Het
Ermard G A 17: 15,056,803 R429H probably benign Het
Extl1 C T 4: 134,371,618 G34D probably benign Het
Gen1 T C 12: 11,241,862 D707G probably benign Het
Hist1h1d C A 13: 23,555,367 T93N possibly damaging Het
Igkv5-37 A C 6: 69,963,515 S48R possibly damaging Het
Ilvbl C T 10: 78,583,975 A571V possibly damaging Het
Itgb1 A G 8: 128,713,237 K136E possibly damaging Het
Naa25 A G 5: 121,424,531 T459A possibly damaging Het
Nr3c2 A G 8: 76,909,992 Y574C probably damaging Het
Nrxn1 C T 17: 91,089,207 probably benign Het
Ntrk3 T A 7: 78,302,740 R576S probably benign Het
Nup210l A G 3: 90,134,597 Y403C probably damaging Het
Olfr693 A G 7: 106,677,574 V304A probably benign Het
Olfr920 T G 9: 38,756,618 L310W probably damaging Het
Otogl T A 10: 107,886,515 Y326F probably damaging Het
Pcdha1 T A 18: 36,931,373 D363E probably damaging Het
Pcdhb3 T A 18: 37,301,921 N313K probably benign Het
Pcdhb9 A C 18: 37,401,549 S199R probably benign Het
Pde4dip C T 3: 97,715,283 D1537N probably damaging Het
Pinx1 A G 14: 63,919,535 K304E probably benign Het
Pnlip T C 19: 58,681,702 V458A probably benign Het
Polr3a C A 14: 24,484,387 M60I probably null Het
Qrich2 G T 11: 116,456,860 S1046* probably null Het
Rps6ka5 G A 12: 100,558,565 P638S probably damaging Het
Slc6a13 T A 6: 121,321,699 N158K probably damaging Het
Sord T C 2: 122,259,080 V187A probably damaging Het
Sult2a2 A G 7: 13,734,785 T59A probably benign Het
Thbs2 T C 17: 14,676,296 D777G probably damaging Het
Tmed9 A G 13: 55,595,532 D159G probably benign Het
Trbc1 A G 6: 41,539,261 I142V Het
Usp17ld A G 7: 103,250,834 V297A probably damaging Het
Vmn1r167 A T 7: 23,504,644 *316R probably null Het
Wdr59 C A 8: 111,521,938 R15L Het
Zfp189 C T 4: 49,529,367 P157S possibly damaging Het
Zfp407 C T 18: 84,560,675 G771D probably damaging Het
Other mutations in Lhx8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01806:Lhx8 APN 3 154322355 missense probably damaging 1.00
IGL01991:Lhx8 APN 3 154324554 missense probably damaging 1.00
R0463:Lhx8 UTSW 3 154328171 splice site probably null
R1449:Lhx8 UTSW 3 154328105 nonsense probably null
R1837:Lhx8 UTSW 3 154328055 missense possibly damaging 0.94
R2272:Lhx8 UTSW 3 154316762 missense probably damaging 1.00
R3196:Lhx8 UTSW 3 154330288 missense probably benign 0.05
R4900:Lhx8 UTSW 3 154330288 missense probably benign 0.01
R5120:Lhx8 UTSW 3 154311695 missense probably damaging 0.99
R5223:Lhx8 UTSW 3 154321644 missense probably damaging 1.00
R5587:Lhx8 UTSW 3 154311679 missense probably damaging 0.99
R6046:Lhx8 UTSW 3 154321703 missense probably damaging 1.00
R7155:Lhx8 UTSW 3 154324584 missense possibly damaging 0.82
R7834:Lhx8 UTSW 3 154311537 missense probably null 0.00
R7917:Lhx8 UTSW 3 154311537 missense probably null 0.00
R8039:Lhx8 UTSW 3 154306939 missense probably damaging 0.98
X0028:Lhx8 UTSW 3 154324575 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CCTTTCAAGGCAGTTAAGTACAC -3'
(R):5'- CATTGCAAGAGGCCAAGGTG -3'

Sequencing Primer
(F):5'- AGTACACATTAACACTCTCGTGG -3'
(R):5'- GTGTGAGGAAACTGGCTGTATAG -3'
Posted On2019-11-26