Incidental Mutation 'R7800:Vmn1r167'
ID600474
Institutional Source Beutler Lab
Gene Symbol Vmn1r167
Ensembl Gene ENSMUSG00000090715
Gene Namevomeronasal 1 receptor 167
SynonymsGm6279
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R7800 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location23503646-23507206 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to T at 23504644 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Arginine at position 316 (*316R)
Ref Sequence ENSEMBL: ENSMUSP00000129193 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164527] [ENSMUST00000227713]
Predicted Effect probably null
Transcript: ENSMUST00000164527
AA Change: *316R
SMART Domains Protein: ENSMUSP00000129193
Gene: ENSMUSG00000090715
AA Change: *316R

DomainStartEndE-ValueType
Pfam:TAS2R 19 307 1.5e-13 PFAM
Pfam:7tm_1 41 299 3.8e-6 PFAM
Pfam:V1R 52 306 2.1e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000227713
AA Change: *316R
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,187,872 D1264G probably benign Het
Ace T C 11: 105,986,058 F1122S probably damaging Het
Actr10 T G 12: 70,943,509 Y112D probably benign Het
Cacnb1 T G 11: 98,009,295 I346L possibly damaging Het
Camsap2 T C 1: 136,281,901 T607A probably damaging Het
Cby3 T C 11: 50,359,348 F32S probably damaging Het
Cers5 G T 15: 99,736,241 H409N probably benign Het
Ces1h A T 8: 93,379,694 L11H Het
Clcnkb T C 4: 141,414,522 Y51C probably benign Het
Cnnm2 A G 19: 46,877,981 E856G probably benign Het
Cnot1 A G 8: 95,765,062 V378A probably benign Het
Crisp4 A C 1: 18,128,749 S154A probably benign Het
Ddx58 T C 4: 40,211,618 E650G probably benign Het
Disp1 C T 1: 183,098,986 R241Q probably benign Het
Ermard G A 17: 15,056,803 R429H probably benign Het
Extl1 C T 4: 134,371,618 G34D probably benign Het
Gen1 T C 12: 11,241,862 D707G probably benign Het
Hist1h1d C A 13: 23,555,367 T93N possibly damaging Het
Igkv5-37 A C 6: 69,963,515 S48R possibly damaging Het
Ilvbl C T 10: 78,583,975 A571V possibly damaging Het
Itgb1 A G 8: 128,713,237 K136E possibly damaging Het
Lhx8 A G 3: 154,321,647 F253L probably damaging Het
Naa25 A G 5: 121,424,531 T459A possibly damaging Het
Nr3c2 A G 8: 76,909,992 Y574C probably damaging Het
Nrxn1 C T 17: 91,089,207 probably benign Het
Ntrk3 T A 7: 78,302,740 R576S probably benign Het
Nup210l A G 3: 90,134,597 Y403C probably damaging Het
Olfr693 A G 7: 106,677,574 V304A probably benign Het
Olfr920 T G 9: 38,756,618 L310W probably damaging Het
Otogl T A 10: 107,886,515 Y326F probably damaging Het
Pcdha1 T A 18: 36,931,373 D363E probably damaging Het
Pcdhb3 T A 18: 37,301,921 N313K probably benign Het
Pcdhb9 A C 18: 37,401,549 S199R probably benign Het
Pde4dip C T 3: 97,715,283 D1537N probably damaging Het
Pinx1 A G 14: 63,919,535 K304E probably benign Het
Pnlip T C 19: 58,681,702 V458A probably benign Het
Polr3a C A 14: 24,484,387 M60I probably null Het
Qrich2 G T 11: 116,456,860 S1046* probably null Het
Rps6ka5 G A 12: 100,558,565 P638S probably damaging Het
Slc6a13 T A 6: 121,321,699 N158K probably damaging Het
Sord T C 2: 122,259,080 V187A probably damaging Het
Sult2a2 A G 7: 13,734,785 T59A probably benign Het
Thbs2 T C 17: 14,676,296 D777G probably damaging Het
Tmed9 A G 13: 55,595,532 D159G probably benign Het
Trbc1 A G 6: 41,539,261 I142V Het
Usp17ld A G 7: 103,250,834 V297A probably damaging Het
Wdr59 C A 8: 111,521,938 R15L Het
Zfp189 C T 4: 49,529,367 P157S possibly damaging Het
Zfp407 C T 18: 84,560,675 G771D probably damaging Het
Other mutations in Vmn1r167
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02137:Vmn1r167 APN 7 23505439 missense probably damaging 0.98
IGL02261:Vmn1r167 APN 7 23504836 missense probably benign 0.17
IGL02963:Vmn1r167 APN 7 23505550 missense possibly damaging 0.60
R0054:Vmn1r167 UTSW 7 23504909 missense possibly damaging 0.89
R0555:Vmn1r167 UTSW 7 23505087 missense probably damaging 1.00
R0766:Vmn1r167 UTSW 7 23505123 missense probably benign 0.01
R1312:Vmn1r167 UTSW 7 23505123 missense probably benign 0.01
R1464:Vmn1r167 UTSW 7 23505256 missense possibly damaging 0.62
R1464:Vmn1r167 UTSW 7 23505256 missense possibly damaging 0.62
R1532:Vmn1r167 UTSW 7 23504779 missense probably benign 0.01
R1937:Vmn1r167 UTSW 7 23505027 missense probably benign 0.25
R2162:Vmn1r167 UTSW 7 23504799 missense possibly damaging 0.91
R4639:Vmn1r167 UTSW 7 23505586 missense probably benign 0.00
R4661:Vmn1r167 UTSW 7 23504692 missense probably damaging 1.00
R4845:Vmn1r167 UTSW 7 23504733 missense probably benign 0.01
R4868:Vmn1r167 UTSW 7 23504736 missense probably benign
R4993:Vmn1r167 UTSW 7 23505228 missense probably damaging 1.00
R5693:Vmn1r167 UTSW 7 23505221 nonsense probably null
R6622:Vmn1r167 UTSW 7 23505589 start codon destroyed probably null
Predicted Primers PCR Primer
(F):5'- TTGCATGACAATCTAACCACCT -3'
(R):5'- TTGTAACCTGTTATCTTCTAGACTGT -3'

Sequencing Primer
(F):5'- AACTTGCAGTTACTCTAGGCCATG -3'
(R):5'- AGACTGTATTTGTACGTTCTGTCAC -3'
Posted On2019-11-26