Incidental Mutation 'R7800:Olfr920'
ID600483
Institutional Source Beutler Lab
Gene Symbol Olfr920
Ensembl Gene ENSMUSG00000061039
Gene Nameolfactory receptor 920
SynonymsMOR165-6, GA_x6K02T2PVTD-32458442-32459374
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R7800 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location38752299-38760117 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 38756618 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Tryptophan at position 310 (L310W)
Ref Sequence ENSEMBL: ENSMUSP00000074300 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074740]
Predicted Effect probably damaging
Transcript: ENSMUST00000074740
AA Change: L310W

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000074300
Gene: ENSMUSG00000061039
AA Change: L310W

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.2e-47 PFAM
Pfam:7tm_1 41 290 3.6e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,187,872 D1264G probably benign Het
Ace T C 11: 105,986,058 F1122S probably damaging Het
Actr10 T G 12: 70,943,509 Y112D probably benign Het
Cacnb1 T G 11: 98,009,295 I346L possibly damaging Het
Camsap2 T C 1: 136,281,901 T607A probably damaging Het
Cby3 T C 11: 50,359,348 F32S probably damaging Het
Cers5 G T 15: 99,736,241 H409N probably benign Het
Ces1h A T 8: 93,379,694 L11H Het
Clcnkb T C 4: 141,414,522 Y51C probably benign Het
Cnnm2 A G 19: 46,877,981 E856G probably benign Het
Cnot1 A G 8: 95,765,062 V378A probably benign Het
Crisp4 A C 1: 18,128,749 S154A probably benign Het
Ddx58 T C 4: 40,211,618 E650G probably benign Het
Disp1 C T 1: 183,098,986 R241Q probably benign Het
Ermard G A 17: 15,056,803 R429H probably benign Het
Extl1 C T 4: 134,371,618 G34D probably benign Het
Gen1 T C 12: 11,241,862 D707G probably benign Het
Hist1h1d C A 13: 23,555,367 T93N possibly damaging Het
Igkv5-37 A C 6: 69,963,515 S48R possibly damaging Het
Ilvbl C T 10: 78,583,975 A571V possibly damaging Het
Itgb1 A G 8: 128,713,237 K136E possibly damaging Het
Lhx8 A G 3: 154,321,647 F253L probably damaging Het
Naa25 A G 5: 121,424,531 T459A possibly damaging Het
Nr3c2 A G 8: 76,909,992 Y574C probably damaging Het
Nrxn1 C T 17: 91,089,207 probably benign Het
Ntrk3 T A 7: 78,302,740 R576S probably benign Het
Nup210l A G 3: 90,134,597 Y403C probably damaging Het
Olfr693 A G 7: 106,677,574 V304A probably benign Het
Otogl T A 10: 107,886,515 Y326F probably damaging Het
Pcdha1 T A 18: 36,931,373 D363E probably damaging Het
Pcdhb3 T A 18: 37,301,921 N313K probably benign Het
Pcdhb9 A C 18: 37,401,549 S199R probably benign Het
Pde4dip C T 3: 97,715,283 D1537N probably damaging Het
Pinx1 A G 14: 63,919,535 K304E probably benign Het
Pnlip T C 19: 58,681,702 V458A probably benign Het
Polr3a C A 14: 24,484,387 M60I probably null Het
Qrich2 G T 11: 116,456,860 S1046* probably null Het
Rps6ka5 G A 12: 100,558,565 P638S probably damaging Het
Slc6a13 T A 6: 121,321,699 N158K probably damaging Het
Sord T C 2: 122,259,080 V187A probably damaging Het
Sult2a2 A G 7: 13,734,785 T59A probably benign Het
Thbs2 T C 17: 14,676,296 D777G probably damaging Het
Tmed9 A G 13: 55,595,532 D159G probably benign Het
Trbc1 A G 6: 41,539,261 I142V Het
Usp17ld A G 7: 103,250,834 V297A probably damaging Het
Vmn1r167 A T 7: 23,504,644 *316R probably null Het
Wdr59 C A 8: 111,521,938 R15L Het
Zfp189 C T 4: 49,529,367 P157S possibly damaging Het
Zfp407 C T 18: 84,560,675 G771D probably damaging Het
Other mutations in Olfr920
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01686:Olfr920 APN 9 38756254 missense probably damaging 1.00
IGL01728:Olfr920 APN 9 38756095 missense possibly damaging 0.63
IGL01867:Olfr920 APN 9 38755898 missense probably damaging 1.00
IGL02271:Olfr920 APN 9 38756488 missense probably benign
IGL03078:Olfr920 APN 9 38756245 nonsense probably null
R0166:Olfr920 UTSW 9 38756188 missense probably benign
R0446:Olfr920 UTSW 9 38755818 missense probably damaging 1.00
R0453:Olfr920 UTSW 9 38756129 missense probably damaging 0.99
R0556:Olfr920 UTSW 9 38755745 missense possibly damaging 0.88
R1585:Olfr920 UTSW 9 38756420 missense probably damaging 1.00
R2847:Olfr920 UTSW 9 38756036 missense possibly damaging 0.89
R4676:Olfr920 UTSW 9 38755659 start gained probably benign
R4825:Olfr920 UTSW 9 38756407 missense probably damaging 1.00
R5026:Olfr920 UTSW 9 38755745 missense probably benign 0.01
R5144:Olfr920 UTSW 9 38756393 missense possibly damaging 0.90
R5573:Olfr920 UTSW 9 38755704 missense probably damaging 1.00
R5872:Olfr920 UTSW 9 38756116 missense probably benign 0.06
R6131:Olfr920 UTSW 9 38756066 missense probably damaging 1.00
R6729:Olfr920 UTSW 9 38755828 missense probably benign 0.00
R7731:Olfr920 UTSW 9 38756246 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TGTAGTTCCCACATAATTGCTGTC -3'
(R):5'- AGCCATCTTGTCATGCCTAG -3'

Sequencing Primer
(F):5'- ATAATTGCTGTCTCTCTGTTCTTTGG -3'
(R):5'- AAACATCTCTGATGGGGCCTG -3'
Posted On2019-11-26