Incidental Mutation 'R7800:Abca6'
ID600489
Institutional Source Beutler Lab
Gene Symbol Abca6
Ensembl Gene ENSMUSG00000044749
Gene NameATP-binding cassette, sub-family A (ABC1), member 6
Synonyms6330565N06Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7800 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location110176820-110251776 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110187872 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1264 (D1264G)
Ref Sequence ENSEMBL: ENSMUSP00000035458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044003]
Predicted Effect probably benign
Transcript: ENSMUST00000044003
AA Change: D1264G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000035458
Gene: ENSMUSG00000044749
AA Change: D1264G

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 416 1.4e-42 PFAM
low complexity region 484 495 N/A INTRINSIC
AAA 506 691 1.13e-6 SMART
transmembrane domain 854 876 N/A INTRINSIC
transmembrane domain 971 990 N/A INTRINSIC
transmembrane domain 1005 1027 N/A INTRINSIC
Blast:AAA 1041 1176 4e-21 BLAST
transmembrane domain 1191 1213 N/A INTRINSIC
low complexity region 1243 1254 N/A INTRINSIC
AAA 1312 1505 2.43e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This gene is clustered among 4 other ABC1 family members on 17q24 and may play a role in macrophage lipid homeostasis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace T C 11: 105,986,058 F1122S probably damaging Het
Actr10 T G 12: 70,943,509 Y112D probably benign Het
Cacnb1 T G 11: 98,009,295 I346L possibly damaging Het
Camsap2 T C 1: 136,281,901 T607A probably damaging Het
Cby3 T C 11: 50,359,348 F32S probably damaging Het
Cers5 G T 15: 99,736,241 H409N probably benign Het
Ces1h A T 8: 93,379,694 L11H Het
Clcnkb T C 4: 141,414,522 Y51C probably benign Het
Cnnm2 A G 19: 46,877,981 E856G probably benign Het
Cnot1 A G 8: 95,765,062 V378A probably benign Het
Crisp4 A C 1: 18,128,749 S154A probably benign Het
Ddx58 T C 4: 40,211,618 E650G probably benign Het
Disp1 C T 1: 183,098,986 R241Q probably benign Het
Ermard G A 17: 15,056,803 R429H probably benign Het
Extl1 C T 4: 134,371,618 G34D probably benign Het
Gen1 T C 12: 11,241,862 D707G probably benign Het
Hist1h1d C A 13: 23,555,367 T93N possibly damaging Het
Igkv5-37 A C 6: 69,963,515 S48R possibly damaging Het
Ilvbl C T 10: 78,583,975 A571V possibly damaging Het
Itgb1 A G 8: 128,713,237 K136E possibly damaging Het
Lhx8 A G 3: 154,321,647 F253L probably damaging Het
Naa25 A G 5: 121,424,531 T459A possibly damaging Het
Nr3c2 A G 8: 76,909,992 Y574C probably damaging Het
Nrxn1 C T 17: 91,089,207 probably benign Het
Ntrk3 T A 7: 78,302,740 R576S probably benign Het
Nup210l A G 3: 90,134,597 Y403C probably damaging Het
Olfr693 A G 7: 106,677,574 V304A probably benign Het
Olfr920 T G 9: 38,756,618 L310W probably damaging Het
Otogl T A 10: 107,886,515 Y326F probably damaging Het
Pcdha1 T A 18: 36,931,373 D363E probably damaging Het
Pcdhb3 T A 18: 37,301,921 N313K probably benign Het
Pcdhb9 A C 18: 37,401,549 S199R probably benign Het
Pde4dip C T 3: 97,715,283 D1537N probably damaging Het
Pinx1 A G 14: 63,919,535 K304E probably benign Het
Pnlip T C 19: 58,681,702 V458A probably benign Het
Polr3a C A 14: 24,484,387 M60I probably null Het
Qrich2 G T 11: 116,456,860 S1046* probably null Het
Rps6ka5 G A 12: 100,558,565 P638S probably damaging Het
Slc6a13 T A 6: 121,321,699 N158K probably damaging Het
Sord T C 2: 122,259,080 V187A probably damaging Het
Sult2a2 A G 7: 13,734,785 T59A probably benign Het
Thbs2 T C 17: 14,676,296 D777G probably damaging Het
Tmed9 A G 13: 55,595,532 D159G probably benign Het
Trbc1 A G 6: 41,539,261 I142V Het
Usp17ld A G 7: 103,250,834 V297A probably damaging Het
Vmn1r167 A T 7: 23,504,644 *316R probably null Het
Wdr59 C A 8: 111,521,938 R15L Het
Zfp189 C T 4: 49,529,367 P157S possibly damaging Het
Zfp407 C T 18: 84,560,675 G771D probably damaging Het
Other mutations in Abca6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Abca6 APN 11 110184709 missense probably damaging 1.00
IGL00569:Abca6 APN 11 110187049 missense possibly damaging 0.88
IGL00737:Abca6 APN 11 110196997 splice site probably benign
IGL01024:Abca6 APN 11 110197142 missense probably benign
IGL01087:Abca6 APN 11 110191650 missense probably benign 0.00
IGL01511:Abca6 APN 11 110244310 missense probably benign 0.00
IGL01516:Abca6 APN 11 110218217 missense possibly damaging 0.70
IGL01621:Abca6 APN 11 110184708 missense probably damaging 1.00
IGL01749:Abca6 APN 11 110244224 missense probably damaging 1.00
IGL01934:Abca6 APN 11 110188655 missense probably benign 0.00
IGL02010:Abca6 APN 11 110219616 missense probably benign 0.12
IGL02121:Abca6 APN 11 110182924 missense probably benign 0.38
IGL02423:Abca6 APN 11 110219006 splice site probably benign
IGL02428:Abca6 APN 11 110178792 missense possibly damaging 0.81
IGL02491:Abca6 APN 11 110176968 utr 3 prime probably benign
IGL02541:Abca6 APN 11 110212267 missense probably damaging 1.00
IGL02792:Abca6 APN 11 110188681 missense probably damaging 0.99
IGL02836:Abca6 APN 11 110248548 missense probably damaging 1.00
IGL02965:Abca6 APN 11 110180613 missense probably benign
IGL03094:Abca6 APN 11 110184112 missense probably benign 0.03
IGL03109:Abca6 APN 11 110180347 missense probably damaging 0.96
R0068:Abca6 UTSW 11 110182882 missense probably damaging 1.00
R0142:Abca6 UTSW 11 110188641 missense probably damaging 1.00
R0165:Abca6 UTSW 11 110219604 missense possibly damaging 0.90
R0254:Abca6 UTSW 11 110236789 missense probably benign 0.16
R0598:Abca6 UTSW 11 110197154 missense probably damaging 1.00
R0992:Abca6 UTSW 11 110211684 missense probably damaging 1.00
R1386:Abca6 UTSW 11 110244255 missense probably benign 0.02
R1642:Abca6 UTSW 11 110218281 missense possibly damaging 0.73
R1673:Abca6 UTSW 11 110212339 missense probably benign 0.01
R1792:Abca6 UTSW 11 110184044 missense probably benign 0.00
R1813:Abca6 UTSW 11 110233845 splice site probably benign
R1817:Abca6 UTSW 11 110219318 missense probably benign 0.00
R1842:Abca6 UTSW 11 110197039 missense probably benign 0.00
R1898:Abca6 UTSW 11 110208799 missense probably damaging 0.99
R1914:Abca6 UTSW 11 110212210 missense probably benign 0.06
R1915:Abca6 UTSW 11 110212210 missense probably benign 0.06
R1934:Abca6 UTSW 11 110210083 critical splice donor site probably null
R1964:Abca6 UTSW 11 110184676 missense probably damaging 0.98
R1967:Abca6 UTSW 11 110187148 missense probably benign 0.09
R2127:Abca6 UTSW 11 110219649 missense probably benign 0.00
R2128:Abca6 UTSW 11 110219649 missense probably benign 0.00
R2164:Abca6 UTSW 11 110210193 frame shift probably null
R2895:Abca6 UTSW 11 110202426 missense probably benign 0.00
R3110:Abca6 UTSW 11 110178829 nonsense probably null
R3111:Abca6 UTSW 11 110178829 nonsense probably null
R3112:Abca6 UTSW 11 110178829 nonsense probably null
R4094:Abca6 UTSW 11 110180366 missense probably damaging 1.00
R4432:Abca6 UTSW 11 110241588 missense probably benign 0.11
R4474:Abca6 UTSW 11 110233772 missense possibly damaging 0.46
R4572:Abca6 UTSW 11 110216548 missense probably benign 0.31
R4629:Abca6 UTSW 11 110230549 critical splice acceptor site probably null
R4793:Abca6 UTSW 11 110191718 missense probably benign
R4852:Abca6 UTSW 11 110244203 missense probably benign 0.09
R4867:Abca6 UTSW 11 110202379 missense probably benign 0.01
R4879:Abca6 UTSW 11 110219700 missense probably damaging 0.98
R4918:Abca6 UTSW 11 110180551 missense probably damaging 1.00
R5060:Abca6 UTSW 11 110219604 missense possibly damaging 0.90
R5062:Abca6 UTSW 11 110177066 missense probably benign 0.12
R5083:Abca6 UTSW 11 110218967 missense probably damaging 1.00
R5173:Abca6 UTSW 11 110191720 missense probably benign
R5393:Abca6 UTSW 11 110244295 missense probably benign 0.00
R5484:Abca6 UTSW 11 110184073 missense probably damaging 1.00
R5498:Abca6 UTSW 11 110208844 missense possibly damaging 0.95
R5503:Abca6 UTSW 11 110218257 missense probably damaging 1.00
R5645:Abca6 UTSW 11 110250408 missense probably damaging 0.99
R5680:Abca6 UTSW 11 110236645 missense possibly damaging 0.88
R5761:Abca6 UTSW 11 110210101 missense probably damaging 1.00
R5779:Abca6 UTSW 11 110184670 missense probably benign 0.37
R5818:Abca6 UTSW 11 110219643 missense probably damaging 1.00
R6282:Abca6 UTSW 11 110208824 missense probably damaging 0.98
R6455:Abca6 UTSW 11 110241581 missense probably damaging 1.00
R6826:Abca6 UTSW 11 110216605 missense probably benign 0.15
R6857:Abca6 UTSW 11 110219688 missense possibly damaging 0.63
R6914:Abca6 UTSW 11 110190238 missense probably benign
R6931:Abca6 UTSW 11 110244328 missense probably benign 0.27
R7222:Abca6 UTSW 11 110191693 missense probably benign 0.29
R7242:Abca6 UTSW 11 110241653 missense possibly damaging 0.47
R7297:Abca6 UTSW 11 110183026 critical splice donor site probably null
R7387:Abca6 UTSW 11 110202420 missense probably benign
R7420:Abca6 UTSW 11 110250477 missense probably benign 0.24
R7494:Abca6 UTSW 11 110208745 missense possibly damaging 0.93
R7603:Abca6 UTSW 11 110180258 missense possibly damaging 0.69
R7637:Abca6 UTSW 11 110218952 missense probably benign 0.00
R7674:Abca6 UTSW 11 110219297 missense probably damaging 1.00
R7753:Abca6 UTSW 11 110184107 missense probably damaging 1.00
R7842:Abca6 UTSW 11 110196697 missense possibly damaging 0.76
R7855:Abca6 UTSW 11 110191628 missense probably benign 0.01
R7925:Abca6 UTSW 11 110196697 missense possibly damaging 0.76
R7938:Abca6 UTSW 11 110191628 missense probably benign 0.01
X0024:Abca6 UTSW 11 110244255 missense probably benign 0.02
X0064:Abca6 UTSW 11 110197142 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGAACCTTCTGGGGTATCTGC -3'
(R):5'- CTAAGGCTAGGGACCACATCAC -3'

Sequencing Primer
(F):5'- CTGCGTATTTGGGTATCTACAAAC -3'
(R):5'- ATGCGGGTTCATGCAAGC -3'
Posted On2019-11-26