Incidental Mutation 'R7800:Rps6ka5'
ID600493
Institutional Source Beutler Lab
Gene Symbol Rps6ka5
Ensembl Gene ENSMUSG00000021180
Gene Nameribosomal protein S6 kinase, polypeptide 5
Synonyms6330404E13Rik, MSK1, 3110005L17Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7800 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location100548439-100726983 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 100558565 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 638 (P638S)
Ref Sequence ENSEMBL: ENSMUSP00000042987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043599] [ENSMUST00000222731]
Predicted Effect probably damaging
Transcript: ENSMUST00000043599
AA Change: P638S

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000042987
Gene: ENSMUSG00000021180
AA Change: P638S

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
S_TKc 48 317 1.08e-101 SMART
S_TK_X 318 378 2.45e-13 SMART
S_TKc 425 751 1.1e-75 SMART
low complexity region 812 832 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221356
Predicted Effect possibly damaging
Transcript: ENSMUST00000222731
AA Change: P573S

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a mutant allele exhibit altered response to cocaine including decreased hyperlocomotor activity and sensitization at a lower dose. Mice homozygous for a kinase dead allele exhibit altered experience-dependent synaptic plasticity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,187,872 D1264G probably benign Het
Ace T C 11: 105,986,058 F1122S probably damaging Het
Actr10 T G 12: 70,943,509 Y112D probably benign Het
Cacnb1 T G 11: 98,009,295 I346L possibly damaging Het
Camsap2 T C 1: 136,281,901 T607A probably damaging Het
Cby3 T C 11: 50,359,348 F32S probably damaging Het
Cers5 G T 15: 99,736,241 H409N probably benign Het
Ces1h A T 8: 93,379,694 L11H Het
Clcnkb T C 4: 141,414,522 Y51C probably benign Het
Cnnm2 A G 19: 46,877,981 E856G probably benign Het
Cnot1 A G 8: 95,765,062 V378A probably benign Het
Crisp4 A C 1: 18,128,749 S154A probably benign Het
Ddx58 T C 4: 40,211,618 E650G probably benign Het
Disp1 C T 1: 183,098,986 R241Q probably benign Het
Ermard G A 17: 15,056,803 R429H probably benign Het
Extl1 C T 4: 134,371,618 G34D probably benign Het
Gen1 T C 12: 11,241,862 D707G probably benign Het
Hist1h1d C A 13: 23,555,367 T93N possibly damaging Het
Igkv5-37 A C 6: 69,963,515 S48R possibly damaging Het
Ilvbl C T 10: 78,583,975 A571V possibly damaging Het
Itgb1 A G 8: 128,713,237 K136E possibly damaging Het
Lhx8 A G 3: 154,321,647 F253L probably damaging Het
Naa25 A G 5: 121,424,531 T459A possibly damaging Het
Nr3c2 A G 8: 76,909,992 Y574C probably damaging Het
Nrxn1 C T 17: 91,089,207 probably benign Het
Ntrk3 T A 7: 78,302,740 R576S probably benign Het
Nup210l A G 3: 90,134,597 Y403C probably damaging Het
Olfr693 A G 7: 106,677,574 V304A probably benign Het
Olfr920 T G 9: 38,756,618 L310W probably damaging Het
Otogl T A 10: 107,886,515 Y326F probably damaging Het
Pcdha1 T A 18: 36,931,373 D363E probably damaging Het
Pcdhb3 T A 18: 37,301,921 N313K probably benign Het
Pcdhb9 A C 18: 37,401,549 S199R probably benign Het
Pde4dip C T 3: 97,715,283 D1537N probably damaging Het
Pinx1 A G 14: 63,919,535 K304E probably benign Het
Pnlip T C 19: 58,681,702 V458A probably benign Het
Polr3a C A 14: 24,484,387 M60I probably null Het
Qrich2 G T 11: 116,456,860 S1046* probably null Het
Slc6a13 T A 6: 121,321,699 N158K probably damaging Het
Sord T C 2: 122,259,080 V187A probably damaging Het
Sult2a2 A G 7: 13,734,785 T59A probably benign Het
Thbs2 T C 17: 14,676,296 D777G probably damaging Het
Tmed9 A G 13: 55,595,532 D159G probably benign Het
Trbc1 A G 6: 41,539,261 I142V Het
Usp17ld A G 7: 103,250,834 V297A probably damaging Het
Vmn1r167 A T 7: 23,504,644 *316R probably null Het
Wdr59 C A 8: 111,521,938 R15L Het
Zfp189 C T 4: 49,529,367 P157S possibly damaging Het
Zfp407 C T 18: 84,560,675 G771D probably damaging Het
Other mutations in Rps6ka5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01072:Rps6ka5 APN 12 100573898 missense probably benign
IGL01450:Rps6ka5 APN 12 100552991 splice site probably benign
IGL01586:Rps6ka5 APN 12 100570914 missense probably damaging 0.99
IGL01743:Rps6ka5 APN 12 100575633 critical splice donor site probably null
IGL02995:Rps6ka5 APN 12 100573999 intron probably benign
IGL03051:Rps6ka5 APN 12 100615991 splice site probably null
IGL03190:Rps6ka5 APN 12 100558648 splice site probably benign
R0055:Rps6ka5 UTSW 12 100678580 missense probably damaging 0.97
R0055:Rps6ka5 UTSW 12 100678580 missense probably damaging 0.97
R0067:Rps6ka5 UTSW 12 100616083 missense probably damaging 1.00
R0212:Rps6ka5 UTSW 12 100553169 splice site probably null
R0761:Rps6ka5 UTSW 12 100570882 missense probably damaging 1.00
R0893:Rps6ka5 UTSW 12 100574438 missense possibly damaging 0.71
R1237:Rps6ka5 UTSW 12 100575705 missense possibly damaging 0.85
R1254:Rps6ka5 UTSW 12 100619529 missense probably damaging 1.00
R1447:Rps6ka5 UTSW 12 100577825 missense probably benign 0.02
R1611:Rps6ka5 UTSW 12 100570852 missense possibly damaging 0.77
R2086:Rps6ka5 UTSW 12 100619615 missense possibly damaging 0.67
R2129:Rps6ka5 UTSW 12 100678538 missense probably damaging 0.99
R2298:Rps6ka5 UTSW 12 100551454 missense probably damaging 0.99
R2432:Rps6ka5 UTSW 12 100554405 missense probably damaging 0.98
R4378:Rps6ka5 UTSW 12 100597937 missense probably damaging 1.00
R4394:Rps6ka5 UTSW 12 100581319 missense probably damaging 0.97
R4461:Rps6ka5 UTSW 12 100570864 missense probably damaging 0.99
R4584:Rps6ka5 UTSW 12 100581318 missense probably damaging 1.00
R4672:Rps6ka5 UTSW 12 100654287 missense possibly damaging 0.93
R4706:Rps6ka5 UTSW 12 100581319 missense probably damaging 0.97
R4706:Rps6ka5 UTSW 12 100597885 splice site probably null
R4707:Rps6ka5 UTSW 12 100597885 splice site probably null
R4966:Rps6ka5 UTSW 12 100553066 missense probably benign 0.01
R5059:Rps6ka5 UTSW 12 100554375 missense probably damaging 0.96
R5404:Rps6ka5 UTSW 12 100616093 missense probably damaging 1.00
R5660:Rps6ka5 UTSW 12 100619580 missense possibly damaging 0.95
R5678:Rps6ka5 UTSW 12 100724876 missense unknown
R5992:Rps6ka5 UTSW 12 100575250 missense possibly damaging 0.68
R6104:Rps6ka5 UTSW 12 100553148 missense possibly damaging 0.84
R6163:Rps6ka5 UTSW 12 100595920 critical splice acceptor site probably null
R6390:Rps6ka5 UTSW 12 100570992 missense probably damaging 0.99
R6599:Rps6ka5 UTSW 12 100597909 missense probably damaging 1.00
R6653:Rps6ka5 UTSW 12 100551536 missense probably damaging 1.00
R6693:Rps6ka5 UTSW 12 100573829 missense probably benign 0.11
R7009:Rps6ka5 UTSW 12 100619537 missense probably damaging 1.00
R7157:Rps6ka5 UTSW 12 100581420 missense probably damaging 1.00
R7196:Rps6ka5 UTSW 12 100595864 missense possibly damaging 0.77
R7510:Rps6ka5 UTSW 12 100616068 missense possibly damaging 0.56
R7565:Rps6ka5 UTSW 12 100616083 missense probably damaging 1.00
R7843:Rps6ka5 UTSW 12 100553149 missense possibly damaging 0.92
R7926:Rps6ka5 UTSW 12 100553149 missense possibly damaging 0.92
R8009:Rps6ka5 UTSW 12 100577789 missense probably damaging 0.97
R8057:Rps6ka5 UTSW 12 100573796 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGGGACCACTGCTTGTTATACAG -3'
(R):5'- AGACTATGTGCTCAGGTCAAAC -3'

Sequencing Primer
(F):5'- GGACCACTGCTTGTTATACAGAAAAC -3'
(R):5'- GGTCAAACACCAGAATACACAG -3'
Posted On2019-11-26