Incidental Mutation 'R7800:Hist1h1d'
ID600494
Institutional Source Beutler Lab
Gene Symbol Hist1h1d
Ensembl Gene ENSMUSG00000052565
Gene Namehistone cluster 1, H1d
SynonymsH1s-4, H1.3, H1D, H1f3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7800 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location23553262-23560686 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 23555367 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 93 (T93N)
Ref Sequence ENSEMBL: ENSMUSP00000044395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045301] [ENSMUST00000102971]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045301
AA Change: T93N

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000044395
Gene: ENSMUSG00000052565
AA Change: T93N

DomainStartEndE-ValueType
H15 35 100 4.02e-23 SMART
low complexity region 110 221 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102971
SMART Domains Protein: ENSMUSP00000100036
Gene: ENSMUSG00000069274

DomainStartEndE-ValueType
H4 16 90 2.59e-29 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Histones are basic nuclear proteins responsible for nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H1 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for targeted null mutations are phenotypically normal. However, Hist1h1c/Hist1h1e/Hist1h1d triple knockout mice die by embryonic day 12.5, and heterozygotes are underrepresented. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,187,872 D1264G probably benign Het
Ace T C 11: 105,986,058 F1122S probably damaging Het
Actr10 T G 12: 70,943,509 Y112D probably benign Het
Cacnb1 T G 11: 98,009,295 I346L possibly damaging Het
Camsap2 T C 1: 136,281,901 T607A probably damaging Het
Cby3 T C 11: 50,359,348 F32S probably damaging Het
Cers5 G T 15: 99,736,241 H409N probably benign Het
Ces1h A T 8: 93,379,694 L11H Het
Clcnkb T C 4: 141,414,522 Y51C probably benign Het
Cnnm2 A G 19: 46,877,981 E856G probably benign Het
Cnot1 A G 8: 95,765,062 V378A probably benign Het
Crisp4 A C 1: 18,128,749 S154A probably benign Het
Ddx58 T C 4: 40,211,618 E650G probably benign Het
Disp1 C T 1: 183,098,986 R241Q probably benign Het
Ermard G A 17: 15,056,803 R429H probably benign Het
Extl1 C T 4: 134,371,618 G34D probably benign Het
Gen1 T C 12: 11,241,862 D707G probably benign Het
Igkv5-37 A C 6: 69,963,515 S48R possibly damaging Het
Ilvbl C T 10: 78,583,975 A571V possibly damaging Het
Itgb1 A G 8: 128,713,237 K136E possibly damaging Het
Lhx8 A G 3: 154,321,647 F253L probably damaging Het
Naa25 A G 5: 121,424,531 T459A possibly damaging Het
Nr3c2 A G 8: 76,909,992 Y574C probably damaging Het
Nrxn1 C T 17: 91,089,207 probably benign Het
Ntrk3 T A 7: 78,302,740 R576S probably benign Het
Nup210l A G 3: 90,134,597 Y403C probably damaging Het
Olfr693 A G 7: 106,677,574 V304A probably benign Het
Olfr920 T G 9: 38,756,618 L310W probably damaging Het
Otogl T A 10: 107,886,515 Y326F probably damaging Het
Pcdha1 T A 18: 36,931,373 D363E probably damaging Het
Pcdhb3 T A 18: 37,301,921 N313K probably benign Het
Pcdhb9 A C 18: 37,401,549 S199R probably benign Het
Pde4dip C T 3: 97,715,283 D1537N probably damaging Het
Pinx1 A G 14: 63,919,535 K304E probably benign Het
Pnlip T C 19: 58,681,702 V458A probably benign Het
Polr3a C A 14: 24,484,387 M60I probably null Het
Qrich2 G T 11: 116,456,860 S1046* probably null Het
Rps6ka5 G A 12: 100,558,565 P638S probably damaging Het
Slc6a13 T A 6: 121,321,699 N158K probably damaging Het
Sord T C 2: 122,259,080 V187A probably damaging Het
Sult2a2 A G 7: 13,734,785 T59A probably benign Het
Thbs2 T C 17: 14,676,296 D777G probably damaging Het
Tmed9 A G 13: 55,595,532 D159G probably benign Het
Trbc1 A G 6: 41,539,261 I142V Het
Usp17ld A G 7: 103,250,834 V297A probably damaging Het
Vmn1r167 A T 7: 23,504,644 *316R probably null Het
Wdr59 C A 8: 111,521,938 R15L Het
Zfp189 C T 4: 49,529,367 P157S possibly damaging Het
Zfp407 C T 18: 84,560,675 G771D probably damaging Het
Other mutations in Hist1h1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
tease UTSW 13 23555277 unclassified probably null
R0485:Hist1h1d UTSW 13 23555750 nonsense probably null
R1954:Hist1h1d UTSW 13 23555516 unclassified probably benign
R4773:Hist1h1d UTSW 13 23555402 missense probably damaging 1.00
R6599:Hist1h1d UTSW 13 23555277 unclassified probably null
R7902:Hist1h1d UTSW 13 23555331 missense probably damaging 0.96
R7985:Hist1h1d UTSW 13 23555331 missense probably damaging 0.96
X0065:Hist1h1d UTSW 13 23555147 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGCACCTGTGGAGAAGACAC -3'
(R):5'- TTGGAAACTTTCTTGGCGCC -3'

Sequencing Primer
(F):5'- CACCTGTGGAGAAGACACCTGTG -3'
(R):5'- CGGAGTCTTCTTGGCCGTC -3'
Posted On2019-11-26