Incidental Mutation 'R7800:Pcdhb3'
ID600503
Institutional Source Beutler Lab
Gene Symbol Pcdhb3
Ensembl Gene ENSMUSG00000045498
Gene Nameprotocadherin beta 3
SynonymsPcdhbC
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R7800 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location37300799-37304585 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37301921 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 313 (N313K)
Ref Sequence ENSEMBL: ENSMUSP00000059180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051754] [ENSMUST00000056522] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000051754
AA Change: N313K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000059180
Gene: ENSMUSG00000045498
AA Change: N313K

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
CA 44 131 6.29e-1 SMART
CA 155 240 7.16e-21 SMART
CA 264 345 1.22e-23 SMART
CA 368 449 2.86e-20 SMART
CA 473 559 2.55e-26 SMART
CA 589 670 1.11e-8 SMART
Pfam:Cadherin_C_2 687 770 9.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056522
SMART Domains Protein: ENSMUSP00000057921
Gene: ENSMUSG00000051599

DomainStartEndE-ValueType
Pfam:Cadherin_2 32 114 5.2e-33 PFAM
CA 157 242 1.74e-19 SMART
CA 266 347 5.99e-23 SMART
CA 370 451 1.16e-20 SMART
CA 475 561 5.94e-27 SMART
CA 591 672 2.03e-11 SMART
Pfam:Cadherin_C_2 688 771 3.5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,187,872 D1264G probably benign Het
Ace T C 11: 105,986,058 F1122S probably damaging Het
Actr10 T G 12: 70,943,509 Y112D probably benign Het
Cacnb1 T G 11: 98,009,295 I346L possibly damaging Het
Camsap2 T C 1: 136,281,901 T607A probably damaging Het
Cby3 T C 11: 50,359,348 F32S probably damaging Het
Cers5 G T 15: 99,736,241 H409N probably benign Het
Ces1h A T 8: 93,379,694 L11H Het
Clcnkb T C 4: 141,414,522 Y51C probably benign Het
Cnnm2 A G 19: 46,877,981 E856G probably benign Het
Cnot1 A G 8: 95,765,062 V378A probably benign Het
Crisp4 A C 1: 18,128,749 S154A probably benign Het
Ddx58 T C 4: 40,211,618 E650G probably benign Het
Disp1 C T 1: 183,098,986 R241Q probably benign Het
Ermard G A 17: 15,056,803 R429H probably benign Het
Extl1 C T 4: 134,371,618 G34D probably benign Het
Gen1 T C 12: 11,241,862 D707G probably benign Het
Hist1h1d C A 13: 23,555,367 T93N possibly damaging Het
Igkv5-37 A C 6: 69,963,515 S48R possibly damaging Het
Ilvbl C T 10: 78,583,975 A571V possibly damaging Het
Itgb1 A G 8: 128,713,237 K136E possibly damaging Het
Lhx8 A G 3: 154,321,647 F253L probably damaging Het
Naa25 A G 5: 121,424,531 T459A possibly damaging Het
Nr3c2 A G 8: 76,909,992 Y574C probably damaging Het
Nrxn1 C T 17: 91,089,207 probably benign Het
Ntrk3 T A 7: 78,302,740 R576S probably benign Het
Nup210l A G 3: 90,134,597 Y403C probably damaging Het
Olfr693 A G 7: 106,677,574 V304A probably benign Het
Olfr920 T G 9: 38,756,618 L310W probably damaging Het
Otogl T A 10: 107,886,515 Y326F probably damaging Het
Pcdha1 T A 18: 36,931,373 D363E probably damaging Het
Pcdhb9 A C 18: 37,401,549 S199R probably benign Het
Pde4dip C T 3: 97,715,283 D1537N probably damaging Het
Pinx1 A G 14: 63,919,535 K304E probably benign Het
Pnlip T C 19: 58,681,702 V458A probably benign Het
Polr3a C A 14: 24,484,387 M60I probably null Het
Qrich2 G T 11: 116,456,860 S1046* probably null Het
Rps6ka5 G A 12: 100,558,565 P638S probably damaging Het
Slc6a13 T A 6: 121,321,699 N158K probably damaging Het
Sord T C 2: 122,259,080 V187A probably damaging Het
Sult2a2 A G 7: 13,734,785 T59A probably benign Het
Thbs2 T C 17: 14,676,296 D777G probably damaging Het
Tmed9 A G 13: 55,595,532 D159G probably benign Het
Trbc1 A G 6: 41,539,261 I142V Het
Usp17ld A G 7: 103,250,834 V297A probably damaging Het
Vmn1r167 A T 7: 23,504,644 *316R probably null Het
Wdr59 C A 8: 111,521,938 R15L Het
Zfp189 C T 4: 49,529,367 P157S possibly damaging Het
Zfp407 C T 18: 84,560,675 G771D probably damaging Het
Other mutations in Pcdhb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00976:Pcdhb3 APN 18 37302948 missense probably benign 0.12
IGL01568:Pcdhb3 APN 18 37302001 missense possibly damaging 0.74
IGL02541:Pcdhb3 APN 18 37302145 missense probably damaging 0.99
IGL02852:Pcdhb3 APN 18 37302097 missense probably damaging 1.00
IGL03140:Pcdhb3 APN 18 37301219 missense probably benign 0.00
IGL03336:Pcdhb3 APN 18 37302961 missense possibly damaging 0.86
R0380:Pcdhb3 UTSW 18 37302157 missense possibly damaging 0.48
R1558:Pcdhb3 UTSW 18 37301581 missense probably damaging 1.00
R1713:Pcdhb3 UTSW 18 37303322 missense probably benign
R1728:Pcdhb3 UTSW 18 37301878 missense probably damaging 1.00
R1784:Pcdhb3 UTSW 18 37301878 missense probably damaging 1.00
R1838:Pcdhb3 UTSW 18 37301317 missense probably benign 0.00
R2079:Pcdhb3 UTSW 18 37303309 missense possibly damaging 0.93
R2164:Pcdhb3 UTSW 18 37302186 missense possibly damaging 0.78
R2513:Pcdhb3 UTSW 18 37301239 nonsense probably null
R2513:Pcdhb3 UTSW 18 37301240 missense probably damaging 1.00
R2513:Pcdhb3 UTSW 18 37301241 missense probably benign 0.17
R3080:Pcdhb3 UTSW 18 37301482 missense probably damaging 1.00
R3755:Pcdhb3 UTSW 18 37302825 missense probably damaging 0.97
R3756:Pcdhb3 UTSW 18 37302825 missense probably damaging 0.97
R3862:Pcdhb3 UTSW 18 37303276 missense probably damaging 1.00
R3863:Pcdhb3 UTSW 18 37303276 missense probably damaging 1.00
R3864:Pcdhb3 UTSW 18 37303276 missense probably damaging 1.00
R4114:Pcdhb3 UTSW 18 37302040 missense probably benign 0.03
R4895:Pcdhb3 UTSW 18 37301706 missense probably damaging 1.00
R4917:Pcdhb3 UTSW 18 37302399 missense probably damaging 0.99
R5508:Pcdhb3 UTSW 18 37301126 missense probably damaging 1.00
R5779:Pcdhb3 UTSW 18 37301467 missense probably benign 0.26
R5848:Pcdhb3 UTSW 18 37301647 missense probably benign 0.39
R5991:Pcdhb3 UTSW 18 37301508 missense probably benign 0.07
R6014:Pcdhb3 UTSW 18 37302653 missense probably damaging 1.00
R6111:Pcdhb3 UTSW 18 37302189 missense probably benign 0.00
R6282:Pcdhb3 UTSW 18 37301646 missense probably damaging 1.00
R6339:Pcdhb3 UTSW 18 37300945 intron probably benign
R6425:Pcdhb3 UTSW 18 37302475 missense possibly damaging 0.64
R6860:Pcdhb3 UTSW 18 37301710 missense probably benign 0.01
R6896:Pcdhb3 UTSW 18 37301212 missense probably damaging 1.00
R6946:Pcdhb3 UTSW 18 37302619 missense probably damaging 1.00
R7110:Pcdhb3 UTSW 18 37302922 missense possibly damaging 0.87
R7236:Pcdhb3 UTSW 18 37301452 missense probably damaging 1.00
R7402:Pcdhb3 UTSW 18 37301604 missense probably benign
R7469:Pcdhb3 UTSW 18 37301335 missense probably benign 0.02
R7723:Pcdhb3 UTSW 18 37302512 missense probably damaging 0.98
R7738:Pcdhb3 UTSW 18 37302959 missense probably benign 0.00
R7817:Pcdhb3 UTSW 18 37302929 missense probably benign
X0026:Pcdhb3 UTSW 18 37301764 missense probably damaging 0.96
X0066:Pcdhb3 UTSW 18 37302339 nonsense probably null
Z1177:Pcdhb3 UTSW 18 37302036 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGCCCCAGAATTTACACAGTC -3'
(R):5'- TGGAACATGTCACTCTTCCG -3'

Sequencing Primer
(F):5'- ACACAGTCACTCTATGAGGTTC -3'
(R):5'- CCGTTATCTCCAGAGTCTAAATCAG -3'
Posted On2019-11-26