Incidental Mutation 'R7801:Agap1'
List [record 1 of 47] next >> last >|
ID600508
Institutional Source Beutler Lab
Gene Symbol Agap1
Ensembl Gene ENSMUSG00000055013
Gene NameArfGAP with GTPase domain, ankyrin repeat and PH domain 1
SynonymsGgap1, Centg2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.291) question?
Stock #R7801 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location89454806-89897617 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89630485 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 165 (Y165C)
Ref Sequence ENSEMBL: ENSMUSP00000027521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027521] [ENSMUST00000074945] [ENSMUST00000190096] [ENSMUST00000212721]
Predicted Effect probably damaging
Transcript: ENSMUST00000027521
AA Change: Y165C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027521
Gene: ENSMUSG00000055013
AA Change: Y165C

DomainStartEndE-ValueType
Pfam:Ras 73 231 1.1e-18 PFAM
low complexity region 269 289 N/A INTRINSIC
PH 347 590 1.36e-15 SMART
ArfGap 609 729 4.58e-51 SMART
ANK 768 797 1.83e-3 SMART
ANK 801 832 1.33e2 SMART
low complexity region 840 852 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000074945
AA Change: Y31C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074478
Gene: ENSMUSG00000055013
AA Change: Y31C

DomainStartEndE-ValueType
Pfam:Miro 73 181 5e-24 PFAM
Pfam:Ras 73 231 3e-19 PFAM
low complexity region 269 289 N/A INTRINSIC
PH 347 537 7.93e-17 SMART
ArfGap 556 676 4.58e-51 SMART
ANK 715 744 1.83e-3 SMART
ANK 748 779 1.33e2 SMART
low complexity region 787 799 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190096
AA Change: Y165C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140599
Gene: ENSMUSG00000055013
AA Change: Y165C

DomainStartEndE-ValueType
Pfam:Miro 73 181 5e-24 PFAM
Pfam:Ras 73 231 3e-19 PFAM
low complexity region 269 289 N/A INTRINSIC
PH 347 537 7.93e-17 SMART
ArfGap 556 676 4.58e-51 SMART
ANK 715 744 1.83e-3 SMART
ANK 748 779 1.33e2 SMART
low complexity region 787 799 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000212721
Meta Mutation Damage Score 0.3565 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of an ADP-ribosylation factor GTPase-activating protein family involved in membrane trafficking and cytoskeleton dynamics. This gene functions as a direct regulator of the adaptor-related protein complex 3 on endosomes. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl3 A T 6: 34,839,365 T742S probably benign Het
Arhgef10l T C 4: 140,544,267 T651A probably benign Het
Arsb T A 13: 93,862,327 I381N probably damaging Het
Blzf1 A G 1: 164,295,909 V283A probably benign Het
C130060K24Rik T A 6: 65,441,217 V123D probably damaging Het
Cadps C T 14: 12,489,476 probably null Het
Casz1 A T 4: 148,938,249 T591S probably damaging Het
Ccne2 T C 4: 11,194,079 probably null Het
Chst9 T C 18: 15,452,277 T410A probably benign Het
Ciart G A 3: 95,881,344 P61L probably damaging Het
Fam234a T C 17: 26,218,198 D169G probably benign Het
Fat1 C T 8: 45,042,223 P4116L probably damaging Het
Fbxo21 G T 5: 117,986,124 A166S probably damaging Het
Gbf1 A G 19: 46,272,643 I1216V probably benign Het
Gper1 G A 5: 139,426,688 A263T probably benign Het
Hdlbp G T 1: 93,430,307 probably null Het
Ighg3 A T 12: 113,359,816 L280Q Het
Impa1 T C 3: 10,321,667 T171A probably benign Het
Ints7 T A 1: 191,615,747 Y744N possibly damaging Het
Irgc1 G T 7: 24,432,534 A286D probably damaging Het
Kif18a T C 2: 109,287,845 S2P probably damaging Het
Macf1 A T 4: 123,408,271 W813R probably damaging Het
Mapkbp1 T G 2: 120,012,073 H157Q probably damaging Het
Mfsd4b2 T A 10: 39,923,781 M42L probably benign Het
Mon2 A G 10: 123,059,186 probably null Het
Myrfl T A 10: 116,848,335 H161L probably benign Het
Olfr171 T C 16: 19,624,623 H159R probably damaging Het
Olfr832 A C 9: 18,945,259 S204R probably damaging Het
Phlpp2 T G 8: 109,925,842 V606G possibly damaging Het
Psmb5 T C 14: 54,616,755 T89A probably benign Het
Ptpn9 A G 9: 57,061,013 T546A probably benign Het
Rabep2 A G 7: 126,438,412 M146V possibly damaging Het
Rptn G A 3: 93,398,224 E955K possibly damaging Het
Samd3 G T 10: 26,263,872 V301F possibly damaging Het
Sh2b1 C A 7: 126,471,292 C380F probably benign Het
Shank1 A G 7: 44,351,598 M914V unknown Het
Sox2 G A 3: 34,650,642 R76H probably damaging Het
Stat5a T C 11: 100,880,317 F574S probably damaging Het
Tbx5 A G 5: 119,836,999 E29G probably benign Het
Trpm5 A C 7: 143,085,241 D264E probably damaging Het
Zfp442 T C 2: 150,409,719 S88G probably benign Het
Zfp62 T A 11: 49,217,328 F749I possibly damaging Het
Zfp677 T A 17: 21,398,015 S445T probably damaging Het
Zfp979 A C 4: 147,613,978 N91K probably damaging Het
Zfyve9 A G 4: 108,684,995 V209A possibly damaging Het
Zic4 G T 9: 91,384,244 A314S probably benign Het
Other mutations in Agap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Agap1 APN 1 89663796 splice site probably benign
IGL00310:Agap1 APN 1 89887670 missense probably damaging 1.00
IGL01104:Agap1 APN 1 89726075 splice site probably benign
IGL02227:Agap1 APN 1 89663775 missense probably damaging 0.99
IGL02959:Agap1 APN 1 89843191 missense possibly damaging 0.94
IGL03303:Agap1 APN 1 89665152 missense probably damaging 1.00
K3955:Agap1 UTSW 1 89887604 missense probably damaging 1.00
R0030:Agap1 UTSW 1 89888744 nonsense probably null
R0234:Agap1 UTSW 1 89671212 missense probably damaging 1.00
R0234:Agap1 UTSW 1 89671212 missense probably damaging 1.00
R0400:Agap1 UTSW 1 89843250 splice site probably benign
R1104:Agap1 UTSW 1 89789240 missense probably damaging 0.99
R1160:Agap1 UTSW 1 89843154 missense probably damaging 0.98
R1439:Agap1 UTSW 1 89843186 missense probably damaging 1.00
R1454:Agap1 UTSW 1 89837806 splice site probably null
R1644:Agap1 UTSW 1 89663730 missense probably damaging 0.97
R1984:Agap1 UTSW 1 89766323 missense probably benign
R2141:Agap1 UTSW 1 89837755 missense probably damaging 0.99
R3966:Agap1 UTSW 1 89834461 missense probably damaging 0.99
R4195:Agap1 UTSW 1 89834539 missense probably damaging 0.99
R4669:Agap1 UTSW 1 89837806 splice site probably null
R4951:Agap1 UTSW 1 89609503 missense probably damaging 1.00
R5525:Agap1 UTSW 1 89743773 missense possibly damaging 0.86
R5843:Agap1 UTSW 1 89609550 missense probably damaging 0.97
R5930:Agap1 UTSW 1 89843096 missense probably damaging 1.00
R6030:Agap1 UTSW 1 89630434 missense probably damaging 1.00
R6030:Agap1 UTSW 1 89630434 missense probably damaging 1.00
R6879:Agap1 UTSW 1 89766455 missense probably benign 0.25
R7027:Agap1 UTSW 1 89888722 missense probably benign 0.00
R7207:Agap1 UTSW 1 89843099 missense possibly damaging 0.91
R7268:Agap1 UTSW 1 89766348 missense probably benign 0.02
R7289:Agap1 UTSW 1 89455431 start codon destroyed probably null 0.01
R7689:Agap1 UTSW 1 89834466 missense probably damaging 1.00
R7690:Agap1 UTSW 1 89843071 missense probably benign 0.43
R7849:Agap1 UTSW 1 89630419 missense probably damaging 0.99
R8364:Agap1 UTSW 1 89887674 missense probably damaging 1.00
RF015:Agap1 UTSW 1 89634263 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGTAATTTGGCCATAGTGCATAC -3'
(R):5'- CCTGAGTGTCATTTCCATAGCAC -3'

Sequencing Primer
(F):5'- TGCATACACGGACGTCAG -3'
(R):5'- CACGTGATGGTAATTCTCATTCTG -3'
Posted On2019-11-26