Incidental Mutation 'R7801:Sox2'
List |< first << previous [record 38 of 47] next >> last >|
ID600515
Institutional Source Beutler Lab
Gene Symbol Sox2
Ensembl Gene ENSMUSG00000074637
Gene NameSRY (sex determining region Y)-box 2
Synonymsysb, Sox-2, lcc
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7801 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location34650405-34652461 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 34650642 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 76 (R76H)
Ref Sequence ENSEMBL: ENSMUSP00000096755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099151]
Predicted Effect probably damaging
Transcript: ENSMUST00000099151
AA Change: R76H

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000096755
Gene: ENSMUSG00000074637
AA Change: R76H

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
HMG 42 112 1.8e-28 SMART
low complexity region 137 156 N/A INTRINSIC
low complexity region 248 263 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: This intronless gene encodes a member of the SRY-related HMG-box (SOX) family of transcription factors involved in the regulation of embryonic development and in the determination of cell fate. The product of this gene is required for stem-cell maintenance in the central nervous system, and also regulates gene expression in the stomach. Mutations in a similar gene in human have been associated with optic nerve hypoplasia and with syndromic microphthalmia, a severe form of structural eye malformation. This gene lies within an intron of another gene called SOX2 overlapping transcript (Sox2ot). [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for targeted null mutations implant but fail to develop an egg cylinder or epiblast, and die shortly thereafter. Other mutations that affect only regulatory elements show circling behavior and deafness, inner ear defects, and a yellow coat color. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 A G 1: 89,630,485 Y165C probably damaging Het
Agbl3 A T 6: 34,839,365 T742S probably benign Het
Arhgef10l T C 4: 140,544,267 T651A probably benign Het
Arsb T A 13: 93,862,327 I381N probably damaging Het
Blzf1 A G 1: 164,295,909 V283A probably benign Het
C130060K24Rik T A 6: 65,441,217 V123D probably damaging Het
Cadps C T 14: 12,489,476 probably null Het
Casz1 A T 4: 148,938,249 T591S probably damaging Het
Ccne2 T C 4: 11,194,079 probably null Het
Chst9 T C 18: 15,452,277 T410A probably benign Het
Ciart G A 3: 95,881,344 P61L probably damaging Het
Fam234a T C 17: 26,218,198 D169G probably benign Het
Fat1 C T 8: 45,042,223 P4116L probably damaging Het
Fbxo21 G T 5: 117,986,124 A166S probably damaging Het
Gbf1 A G 19: 46,272,643 I1216V probably benign Het
Gper1 G A 5: 139,426,688 A263T probably benign Het
Hdlbp G T 1: 93,430,307 probably null Het
Ighg3 A T 12: 113,359,816 L280Q Het
Impa1 T C 3: 10,321,667 T171A probably benign Het
Ints7 T A 1: 191,615,747 Y744N possibly damaging Het
Irgc1 G T 7: 24,432,534 A286D probably damaging Het
Kif18a T C 2: 109,287,845 S2P probably damaging Het
Macf1 A T 4: 123,408,271 W813R probably damaging Het
Mapkbp1 T G 2: 120,012,073 H157Q probably damaging Het
Mfsd4b2 T A 10: 39,923,781 M42L probably benign Het
Mon2 A G 10: 123,059,186 probably null Het
Myrfl T A 10: 116,848,335 H161L probably benign Het
Olfr171 T C 16: 19,624,623 H159R probably damaging Het
Olfr832 A C 9: 18,945,259 S204R probably damaging Het
Phlpp2 T G 8: 109,925,842 V606G possibly damaging Het
Psmb5 T C 14: 54,616,755 T89A probably benign Het
Ptpn9 A G 9: 57,061,013 T546A probably benign Het
Rabep2 A G 7: 126,438,412 M146V possibly damaging Het
Rptn G A 3: 93,398,224 E955K possibly damaging Het
Samd3 G T 10: 26,263,872 V301F possibly damaging Het
Sh2b1 C A 7: 126,471,292 C380F probably benign Het
Shank1 A G 7: 44,351,598 M914V unknown Het
Stat5a T C 11: 100,880,317 F574S probably damaging Het
Tbx5 A G 5: 119,836,999 E29G probably benign Het
Trpm5 A C 7: 143,085,241 D264E probably damaging Het
Zfp442 T C 2: 150,409,719 S88G probably benign Het
Zfp62 T A 11: 49,217,328 F749I possibly damaging Het
Zfp677 T A 17: 21,398,015 S445T probably damaging Het
Zfp979 A C 4: 147,613,978 N91K probably damaging Het
Zfyve9 A G 4: 108,684,995 V209A possibly damaging Het
Zic4 G T 9: 91,384,244 A314S probably benign Het
Other mutations in Sox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02578:Sox2 APN 3 34650596 missense probably benign 0.37
IGL03397:Sox2 APN 3 34650537 missense probably damaging 0.99
R1164:Sox2 UTSW 3 34650699 missense probably damaging 1.00
R1667:Sox2 UTSW 3 34650419 missense probably damaging 1.00
R1829:Sox2 UTSW 3 34650741 missense probably damaging 0.99
R1925:Sox2 UTSW 3 34650671 nonsense probably null
R2066:Sox2 UTSW 3 34651307 missense possibly damaging 0.63
R4170:Sox2 UTSW 3 34650554 missense probably damaging 0.99
R4585:Sox2 UTSW 3 34651044 missense probably benign 0.02
R4586:Sox2 UTSW 3 34651044 missense probably benign 0.02
R4703:Sox2 UTSW 3 34650713 missense probably damaging 1.00
R5509:Sox2 UTSW 3 34650789 missense probably damaging 0.98
R5549:Sox2 UTSW 3 34650993 missense probably benign 0.01
R5637:Sox2 UTSW 3 34650528 missense probably benign 0.03
R6494:Sox2 UTSW 3 34651097 missense probably benign 0.01
R7117:Sox2 UTSW 3 34650926 missense possibly damaging 0.95
R7210:Sox2 UTSW 3 34651157 missense probably damaging 1.00
R7365:Sox2 UTSW 3 34650972 missense possibly damaging 0.60
R7798:Sox2 UTSW 3 34650642 missense probably damaging 0.96
X0024:Sox2 UTSW 3 34650689 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAATCACAACAATCGCGGCGG -3'
(R):5'- TTGCTCCAGCCGTTCATGTG -3'

Sequencing Primer
(F):5'- AGCGCCCGCATGTATAAC -3'
(R):5'- CCGTTCATGTGCGCGTAG -3'
Posted On2019-11-26