Incidental Mutation 'R7801:Ciart'
ID600517
Institutional Source Beutler Lab
Gene Symbol Ciart
Ensembl Gene ENSMUSG00000038550
Gene Namecircadian associated repressor of transcription
SynonymsGm129, LOC229599
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R7801 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location95878503-95882251 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 95881344 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 61 (P61L)
Ref Sequence ENSEMBL: ENSMUSP00000049308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036360] [ENSMUST00000036418] [ENSMUST00000090476] [ENSMUST00000159739] [ENSMUST00000159863] [ENSMUST00000161866] [ENSMUST00000161867] [ENSMUST00000161994] [ENSMUST00000171519]
Predicted Effect probably benign
Transcript: ENSMUST00000036360
SMART Domains Protein: ENSMUSP00000046810
Gene: ENSMUSG00000038543

DomainStartEndE-ValueType
Pfam:DUF4634 1 145 3.6e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000036418
AA Change: P61L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049308
Gene: ENSMUSG00000038550
AA Change: P61L

DomainStartEndE-ValueType
low complexity region 2 33 N/A INTRINSIC
low complexity region 52 61 N/A INTRINSIC
low complexity region 300 315 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090476
SMART Domains Protein: ENSMUSP00000102749
Gene: ENSMUSG00000038543

DomainStartEndE-ValueType
Pfam:DUF4634 1 146 1.8e-65 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159739
AA Change: P61L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124943
Gene: ENSMUSG00000038550
AA Change: P61L

DomainStartEndE-ValueType
low complexity region 2 33 N/A INTRINSIC
low complexity region 52 61 N/A INTRINSIC
Pfam:DUF4664 85 361 3.3e-170 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159863
Predicted Effect probably benign
Transcript: ENSMUST00000161866
SMART Domains Protein: ENSMUSP00000135072
Gene: ENSMUSG00000038550

DomainStartEndE-ValueType
low complexity region 166 181 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161867
Predicted Effect probably damaging
Transcript: ENSMUST00000161994
AA Change: P61L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124125
Gene: ENSMUSG00000038550
AA Change: P61L

DomainStartEndE-ValueType
low complexity region 2 33 N/A INTRINSIC
low complexity region 52 61 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171519
SMART Domains Protein: ENSMUSP00000127666
Gene: ENSMUSG00000038543

DomainStartEndE-ValueType
Pfam:DUF4634 1 146 1.5e-65 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (47/47)
MGI Phenotype PHENOTYPE: Null mutants have slightly prolonged expression of circadian genes [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 A G 1: 89,630,485 Y165C probably damaging Het
Agbl3 A T 6: 34,839,365 T742S probably benign Het
Arhgef10l T C 4: 140,544,267 T651A probably benign Het
Arsb T A 13: 93,862,327 I381N probably damaging Het
Blzf1 A G 1: 164,295,909 V283A probably benign Het
C130060K24Rik T A 6: 65,441,217 V123D probably damaging Het
Cadps C T 14: 12,489,476 probably null Het
Casz1 A T 4: 148,938,249 T591S probably damaging Het
Ccne2 T C 4: 11,194,079 probably null Het
Chst9 T C 18: 15,452,277 T410A probably benign Het
Fam234a T C 17: 26,218,198 D169G probably benign Het
Fat1 C T 8: 45,042,223 P4116L probably damaging Het
Fbxo21 G T 5: 117,986,124 A166S probably damaging Het
Gbf1 A G 19: 46,272,643 I1216V probably benign Het
Gper1 G A 5: 139,426,688 A263T probably benign Het
Hdlbp G T 1: 93,430,307 probably null Het
Ighg3 A T 12: 113,359,816 L280Q Het
Impa1 T C 3: 10,321,667 T171A probably benign Het
Ints7 T A 1: 191,615,747 Y744N possibly damaging Het
Irgc1 G T 7: 24,432,534 A286D probably damaging Het
Kif18a T C 2: 109,287,845 S2P probably damaging Het
Macf1 A T 4: 123,408,271 W813R probably damaging Het
Mapkbp1 T G 2: 120,012,073 H157Q probably damaging Het
Mfsd4b2 T A 10: 39,923,781 M42L probably benign Het
Mon2 A G 10: 123,059,186 probably null Het
Myrfl T A 10: 116,848,335 H161L probably benign Het
Olfr171 T C 16: 19,624,623 H159R probably damaging Het
Olfr832 A C 9: 18,945,259 S204R probably damaging Het
Phlpp2 T G 8: 109,925,842 V606G possibly damaging Het
Psmb5 T C 14: 54,616,755 T89A probably benign Het
Ptpn9 A G 9: 57,061,013 T546A probably benign Het
Rabep2 A G 7: 126,438,412 M146V possibly damaging Het
Rptn G A 3: 93,398,224 E955K possibly damaging Het
Samd3 G T 10: 26,263,872 V301F possibly damaging Het
Sh2b1 C A 7: 126,471,292 C380F probably benign Het
Shank1 A G 7: 44,351,598 M914V unknown Het
Sox2 G A 3: 34,650,642 R76H probably damaging Het
Stat5a T C 11: 100,880,317 F574S probably damaging Het
Tbx5 A G 5: 119,836,999 E29G probably benign Het
Trpm5 A C 7: 143,085,241 D264E probably damaging Het
Zfp442 T C 2: 150,409,719 S88G probably benign Het
Zfp62 T A 11: 49,217,328 F749I possibly damaging Het
Zfp677 T A 17: 21,398,015 S445T probably damaging Het
Zfp979 A C 4: 147,613,978 N91K probably damaging Het
Zfyve9 A G 4: 108,684,995 V209A possibly damaging Het
Zic4 G T 9: 91,384,244 A314S probably benign Het
Other mutations in Ciart
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02943:Ciart APN 3 95879002 missense possibly damaging 0.55
PIT4453001:Ciart UTSW 3 95880476 missense probably damaging 1.00
R2044:Ciart UTSW 3 95878701 missense probably benign 0.00
R2079:Ciart UTSW 3 95879038 missense probably damaging 1.00
R5831:Ciart UTSW 3 95878902 missense probably damaging 0.96
R6251:Ciart UTSW 3 95881011 unclassified probably benign
R7024:Ciart UTSW 3 95879080 missense probably benign 0.30
R7961:Ciart UTSW 3 95881317 missense possibly damaging 0.58
R7993:Ciart UTSW 3 95878894 nonsense probably null
R8009:Ciart UTSW 3 95881317 missense possibly damaging 0.58
R8098:Ciart UTSW 3 95881344 missense probably damaging 1.00
R8099:Ciart UTSW 3 95881344 missense probably damaging 1.00
R8100:Ciart UTSW 3 95881344 missense probably damaging 1.00
Z1177:Ciart UTSW 3 95879023 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCAATTAGGTGTTTGCCACTGC -3'
(R):5'- GCTCCTGGACCTATGGATTC -3'

Sequencing Primer
(F):5'- GCCACTGCACTATCTTTTCTG -3'
(R):5'- TGGATTCTCCATCTAGTGTTTCTTC -3'
Posted On2019-11-26