Incidental Mutation 'R7801:Zfyve9'
List |< first << previous [record 46 of 47] next >> last >|
ID600519
Institutional Source Beutler Lab
Gene Symbol Zfyve9
Ensembl Gene ENSMUSG00000034557
Gene Namezinc finger, FYVE domain containing 9
SynonymsMadhip
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.628) question?
Stock #R7801 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location108637466-108780798 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108684995 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 209 (V209A)
Ref Sequence ENSEMBL: ENSMUSP00000039852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042185] [ENSMUST00000106657] [ENSMUST00000106658]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042185
AA Change: V209A

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000039852
Gene: ENSMUSG00000034557
AA Change: V209A

DomainStartEndE-ValueType
Blast:FYVE 7 40 4e-7 BLAST
Pfam:SARA 52 92 1e-25 PFAM
Pfam:DUF3480 328 681 1.4e-189 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106657
AA Change: V900A

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102268
Gene: ENSMUSG00000034557
AA Change: V900A

DomainStartEndE-ValueType
low complexity region 230 243 N/A INTRINSIC
low complexity region 471 487 N/A INTRINSIC
low complexity region 578 587 N/A INTRINSIC
Blast:FYVE 590 618 7e-6 BLAST
FYVE 663 731 2.38e-26 SMART
Pfam:SARA 745 783 1.3e-22 PFAM
Pfam:DUF3480 1020 1372 1e-178 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106658
AA Change: V841A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000102269
Gene: ENSMUSG00000034557
AA Change: V841A

DomainStartEndE-ValueType
low complexity region 230 243 N/A INTRINSIC
low complexity region 471 487 N/A INTRINSIC
low complexity region 578 587 N/A INTRINSIC
Blast:FYVE 590 618 8e-6 BLAST
FYVE 663 731 2.38e-26 SMART
Pfam:DUF3480 960 1313 5.5e-189 PFAM
Meta Mutation Damage Score 0.0807 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a double zinc finger motif-containing protein that participates in the transforming growth factor-beta (TGFB) signalling pathway. The encoded protein interacts directly with SMAD2 and SMAD3, and recruits SMAD2 to the TGFB receptor. There are multiple pseudogenes for this gene on chromosomes 2, 15, and X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 A G 1: 89,630,485 Y165C probably damaging Het
Agbl3 A T 6: 34,839,365 T742S probably benign Het
Arhgef10l T C 4: 140,544,267 T651A probably benign Het
Arsb T A 13: 93,862,327 I381N probably damaging Het
Blzf1 A G 1: 164,295,909 V283A probably benign Het
C130060K24Rik T A 6: 65,441,217 V123D probably damaging Het
Cadps C T 14: 12,489,476 probably null Het
Casz1 A T 4: 148,938,249 T591S probably damaging Het
Ccne2 T C 4: 11,194,079 probably null Het
Chst9 T C 18: 15,452,277 T410A probably benign Het
Ciart G A 3: 95,881,344 P61L probably damaging Het
Fam234a T C 17: 26,218,198 D169G probably benign Het
Fat1 C T 8: 45,042,223 P4116L probably damaging Het
Fbxo21 G T 5: 117,986,124 A166S probably damaging Het
Gbf1 A G 19: 46,272,643 I1216V probably benign Het
Gper1 G A 5: 139,426,688 A263T probably benign Het
Hdlbp G T 1: 93,430,307 probably null Het
Ighg3 A T 12: 113,359,816 L280Q Het
Impa1 T C 3: 10,321,667 T171A probably benign Het
Ints7 T A 1: 191,615,747 Y744N possibly damaging Het
Irgc1 G T 7: 24,432,534 A286D probably damaging Het
Kif18a T C 2: 109,287,845 S2P probably damaging Het
Macf1 A T 4: 123,408,271 W813R probably damaging Het
Mapkbp1 T G 2: 120,012,073 H157Q probably damaging Het
Mfsd4b2 T A 10: 39,923,781 M42L probably benign Het
Mon2 A G 10: 123,059,186 probably null Het
Myrfl T A 10: 116,848,335 H161L probably benign Het
Olfr171 T C 16: 19,624,623 H159R probably damaging Het
Olfr832 A C 9: 18,945,259 S204R probably damaging Het
Phlpp2 T G 8: 109,925,842 V606G possibly damaging Het
Psmb5 T C 14: 54,616,755 T89A probably benign Het
Ptpn9 A G 9: 57,061,013 T546A probably benign Het
Rabep2 A G 7: 126,438,412 M146V possibly damaging Het
Rptn G A 3: 93,398,224 E955K possibly damaging Het
Samd3 G T 10: 26,263,872 V301F possibly damaging Het
Sh2b1 C A 7: 126,471,292 C380F probably benign Het
Shank1 A G 7: 44,351,598 M914V unknown Het
Sox2 G A 3: 34,650,642 R76H probably damaging Het
Stat5a T C 11: 100,880,317 F574S probably damaging Het
Tbx5 A G 5: 119,836,999 E29G probably benign Het
Trpm5 A C 7: 143,085,241 D264E probably damaging Het
Zfp442 T C 2: 150,409,719 S88G probably benign Het
Zfp62 T A 11: 49,217,328 F749I possibly damaging Het
Zfp677 T A 17: 21,398,015 S445T probably damaging Het
Zfp979 A C 4: 147,613,978 N91K probably damaging Het
Zic4 G T 9: 91,384,244 A314S probably benign Het
Other mutations in Zfyve9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Zfyve9 APN 4 108642107 missense possibly damaging 0.85
IGL01161:Zfyve9 APN 4 108681064 missense probably damaging 1.00
IGL01404:Zfyve9 APN 4 108682151 missense probably damaging 1.00
IGL01451:Zfyve9 APN 4 108682260 missense probably damaging 0.98
IGL01655:Zfyve9 APN 4 108642092 missense probably damaging 1.00
IGL02567:Zfyve9 APN 4 108674523 missense probably damaging 1.00
IGL02593:Zfyve9 APN 4 108682223 missense possibly damaging 0.73
IGL03169:Zfyve9 APN 4 108695825 missense probably damaging 1.00
IGL03206:Zfyve9 APN 4 108689209 missense possibly damaging 0.88
IGL03288:Zfyve9 APN 4 108723799 splice site probably benign
R0008:Zfyve9 UTSW 4 108718705 missense possibly damaging 0.92
R0008:Zfyve9 UTSW 4 108718705 missense possibly damaging 0.92
R0104:Zfyve9 UTSW 4 108718163 missense probably damaging 1.00
R0104:Zfyve9 UTSW 4 108718163 missense probably damaging 1.00
R0362:Zfyve9 UTSW 4 108680969 missense probably damaging 0.96
R0502:Zfyve9 UTSW 4 108719764 nonsense probably null
R0503:Zfyve9 UTSW 4 108719764 nonsense probably null
R0557:Zfyve9 UTSW 4 108674511 missense probably damaging 0.98
R0835:Zfyve9 UTSW 4 108718669 missense probably damaging 0.99
R1215:Zfyve9 UTSW 4 108650229 missense probably benign 0.32
R1245:Zfyve9 UTSW 4 108693311 intron probably benign
R1527:Zfyve9 UTSW 4 108695767 critical splice donor site probably null
R1638:Zfyve9 UTSW 4 108684907 critical splice donor site probably null
R1653:Zfyve9 UTSW 4 108660577 nonsense probably null
R1728:Zfyve9 UTSW 4 108718501 missense possibly damaging 0.80
R1729:Zfyve9 UTSW 4 108718501 missense possibly damaging 0.80
R1861:Zfyve9 UTSW 4 108682295 splice site probably benign
R1983:Zfyve9 UTSW 4 108689189 missense possibly damaging 0.94
R2050:Zfyve9 UTSW 4 108718603 missense probably benign 0.05
R2050:Zfyve9 UTSW 4 108719303 missense possibly damaging 0.94
R2246:Zfyve9 UTSW 4 108689264 missense possibly damaging 0.70
R2338:Zfyve9 UTSW 4 108660614 missense probably damaging 1.00
R2697:Zfyve9 UTSW 4 108695819 missense probably damaging 0.99
R3522:Zfyve9 UTSW 4 108719743 missense probably benign 0.45
R4030:Zfyve9 UTSW 4 108719701 missense possibly damaging 0.61
R4247:Zfyve9 UTSW 4 108719192 missense probably benign 0.28
R4273:Zfyve9 UTSW 4 108680976 missense probably damaging 1.00
R4720:Zfyve9 UTSW 4 108644368 missense possibly damaging 0.94
R4835:Zfyve9 UTSW 4 108717998 missense possibly damaging 0.70
R4871:Zfyve9 UTSW 4 108680986 missense probably damaging 1.00
R4881:Zfyve9 UTSW 4 108727491 splice site probably null
R4974:Zfyve9 UTSW 4 108680900 critical splice donor site probably null
R5024:Zfyve9 UTSW 4 108691669 missense probably benign 0.18
R5481:Zfyve9 UTSW 4 108644349 missense probably damaging 1.00
R5660:Zfyve9 UTSW 4 108719168 missense probably benign
R5965:Zfyve9 UTSW 4 108691681 missense possibly damaging 0.53
R5996:Zfyve9 UTSW 4 108719360 missense probably benign 0.07
R6315:Zfyve9 UTSW 4 108674488 missense probably damaging 1.00
R6772:Zfyve9 UTSW 4 108639269 missense probably damaging 1.00
R6865:Zfyve9 UTSW 4 108644361 missense possibly damaging 0.71
R7112:Zfyve9 UTSW 4 108650322 missense probably benign 0.00
R7258:Zfyve9 UTSW 4 108656954 missense possibly damaging 0.94
R7266:Zfyve9 UTSW 4 108718547 missense possibly damaging 0.62
R7287:Zfyve9 UTSW 4 108718256 missense probably benign 0.00
R7356:Zfyve9 UTSW 4 108719015 missense probably benign 0.01
R7389:Zfyve9 UTSW 4 108693318 critical splice donor site probably null
R7729:Zfyve9 UTSW 4 108691776 missense probably benign 0.01
R7780:Zfyve9 UTSW 4 108719101 missense possibly damaging 0.81
R8069:Zfyve9 UTSW 4 108685018 missense probably benign 0.32
R8201:Zfyve9 UTSW 4 108650277 missense possibly damaging 0.83
R8221:Zfyve9 UTSW 4 108719680 missense possibly damaging 0.77
Z1176:Zfyve9 UTSW 4 108642207 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CCTCACGGCTGCTTTATAGG -3'
(R):5'- AACCAGGACCTGTGTCATCC -3'

Sequencing Primer
(F):5'- TTCAGAACTGGTTCCAGCAG -3'
(R):5'- GGACCTGTGTCATCCTATTATAAATC -3'
Posted On2019-11-26