Incidental Mutation 'R7801:Zfp979'
List |< first << previous [record 45 of 47] next >> last >|
ID600522
Institutional Source Beutler Lab
Gene Symbol Zfp979
Ensembl Gene ENSMUSG00000066000
Gene Namezinc finger protein 979
Synonyms2610305D13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R7801 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location147611937-147642513 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 147613978 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 91 (N91K)
Ref Sequence ENSEMBL: ENSMUSP00000038153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037565] [ENSMUST00000105720] [ENSMUST00000133006]
Predicted Effect probably damaging
Transcript: ENSMUST00000037565
AA Change: N91K

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000038153
Gene: ENSMUSG00000066000
AA Change: N91K

DomainStartEndE-ValueType
KRAB 28 88 2.06e-16 SMART
ZnF_C2H2 257 279 2.06e1 SMART
ZnF_C2H2 285 307 2.53e-2 SMART
ZnF_C2H2 313 335 1.95e-3 SMART
ZnF_C2H2 341 363 1.4e1 SMART
ZnF_C2H2 369 391 9.08e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105720
AA Change: N91K

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101345
Gene: ENSMUSG00000066000
AA Change: N91K

DomainStartEndE-ValueType
KRAB 28 88 2.06e-16 SMART
ZnF_C2H2 257 279 2.06e1 SMART
ZnF_C2H2 285 307 2.53e-2 SMART
ZnF_C2H2 313 335 1.95e-3 SMART
ZnF_C2H2 341 363 1.4e1 SMART
ZnF_C2H2 369 391 9.08e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000133006
AA Change: N91K

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114677
Gene: ENSMUSG00000066000
AA Change: N91K

DomainStartEndE-ValueType
KRAB 28 88 2.06e-16 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 A G 1: 89,630,485 Y165C probably damaging Het
Agbl3 A T 6: 34,839,365 T742S probably benign Het
Arhgef10l T C 4: 140,544,267 T651A probably benign Het
Arsb T A 13: 93,862,327 I381N probably damaging Het
Blzf1 A G 1: 164,295,909 V283A probably benign Het
C130060K24Rik T A 6: 65,441,217 V123D probably damaging Het
Cadps C T 14: 12,489,476 probably null Het
Casz1 A T 4: 148,938,249 T591S probably damaging Het
Ccne2 T C 4: 11,194,079 probably null Het
Chst9 T C 18: 15,452,277 T410A probably benign Het
Ciart G A 3: 95,881,344 P61L probably damaging Het
Fam234a T C 17: 26,218,198 D169G probably benign Het
Fat1 C T 8: 45,042,223 P4116L probably damaging Het
Fbxo21 G T 5: 117,986,124 A166S probably damaging Het
Gbf1 A G 19: 46,272,643 I1216V probably benign Het
Gper1 G A 5: 139,426,688 A263T probably benign Het
Hdlbp G T 1: 93,430,307 probably null Het
Ighg3 A T 12: 113,359,816 L280Q Het
Impa1 T C 3: 10,321,667 T171A probably benign Het
Ints7 T A 1: 191,615,747 Y744N possibly damaging Het
Irgc1 G T 7: 24,432,534 A286D probably damaging Het
Kif18a T C 2: 109,287,845 S2P probably damaging Het
Macf1 A T 4: 123,408,271 W813R probably damaging Het
Mapkbp1 T G 2: 120,012,073 H157Q probably damaging Het
Mfsd4b2 T A 10: 39,923,781 M42L probably benign Het
Mon2 A G 10: 123,059,186 probably null Het
Myrfl T A 10: 116,848,335 H161L probably benign Het
Olfr171 T C 16: 19,624,623 H159R probably damaging Het
Olfr832 A C 9: 18,945,259 S204R probably damaging Het
Phlpp2 T G 8: 109,925,842 V606G possibly damaging Het
Psmb5 T C 14: 54,616,755 T89A probably benign Het
Ptpn9 A G 9: 57,061,013 T546A probably benign Het
Rabep2 A G 7: 126,438,412 M146V possibly damaging Het
Rptn G A 3: 93,398,224 E955K possibly damaging Het
Samd3 G T 10: 26,263,872 V301F possibly damaging Het
Sh2b1 C A 7: 126,471,292 C380F probably benign Het
Shank1 A G 7: 44,351,598 M914V unknown Het
Sox2 G A 3: 34,650,642 R76H probably damaging Het
Stat5a T C 11: 100,880,317 F574S probably damaging Het
Tbx5 A G 5: 119,836,999 E29G probably benign Het
Trpm5 A C 7: 143,085,241 D264E probably damaging Het
Zfp442 T C 2: 150,409,719 S88G probably benign Het
Zfp62 T A 11: 49,217,328 F749I possibly damaging Het
Zfp677 T A 17: 21,398,015 S445T probably damaging Het
Zfyve9 A G 4: 108,684,995 V209A possibly damaging Het
Zic4 G T 9: 91,384,244 A314S probably benign Het
Other mutations in Zfp979
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Zfp979 APN 4 147615396 missense probably damaging 0.98
IGL01865:Zfp979 APN 4 147615317 missense probably benign 0.03
IGL02336:Zfp979 APN 4 147615351 missense probably damaging 1.00
R0336:Zfp979 UTSW 4 147613135 missense possibly damaging 0.86
R1365:Zfp979 UTSW 4 147613224 missense probably benign 0.00
R1440:Zfp979 UTSW 4 147614036 missense possibly damaging 0.96
R1714:Zfp979 UTSW 4 147613985 missense probably damaging 1.00
R1796:Zfp979 UTSW 4 147613283 missense probably damaging 0.99
R2155:Zfp979 UTSW 4 147613458 missense possibly damaging 0.86
R3735:Zfp979 UTSW 4 147613482 missense possibly damaging 0.93
R3963:Zfp979 UTSW 4 147613131 missense probably benign 0.34
R3972:Zfp979 UTSW 4 147618419 nonsense probably null
R4471:Zfp979 UTSW 4 147613456 nonsense probably null
R4983:Zfp979 UTSW 4 147613914 missense possibly damaging 0.94
R5310:Zfp979 UTSW 4 147613918 missense possibly damaging 0.95
R5805:Zfp979 UTSW 4 147613610 missense probably damaging 0.99
R5861:Zfp979 UTSW 4 147613509 nonsense probably null
R6598:Zfp979 UTSW 4 147613766 missense probably damaging 0.99
R6599:Zfp979 UTSW 4 147613626 missense probably benign 0.40
R6925:Zfp979 UTSW 4 147613542 missense possibly damaging 0.86
R7684:Zfp979 UTSW 4 147613342 missense probably damaging 0.99
R8035:Zfp979 UTSW 4 147613306 missense probably damaging 1.00
R8086:Zfp979 UTSW 4 147613547 missense probably damaging 0.99
R8244:Zfp979 UTSW 4 147613476 missense possibly damaging 0.92
R8369:Zfp979 UTSW 4 147613091 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- GTTTACACAGTCTTTATATGTGCAAAC -3'
(R):5'- TCACTTAAAAGTTCTAGATTCTGCAA -3'

Sequencing Primer
(F):5'- CAAACTTCTTTAGTGGTCCGAG -3'
(R):5'- CCTAAACAGCTGGAGTCATTGGTC -3'
Posted On2019-11-26