Incidental Mutation 'R7801:Fbxo21'
List |< first << previous [record 14 of 47] next >> last >|
ID600524
Institutional Source Beutler Lab
Gene Symbol Fbxo21
Ensembl Gene ENSMUSG00000032898
Gene NameF-box protein 21
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.276) question?
Stock #R7801 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location117976730-118010201 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 117986124 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 166 (A166S)
Ref Sequence ENSEMBL: ENSMUSP00000143873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035579] [ENSMUST00000202447]
Predicted Effect probably damaging
Transcript: ENSMUST00000035579
AA Change: A166S

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000035506
Gene: ENSMUSG00000032898
AA Change: A166S

DomainStartEndE-ValueType
low complexity region 15 24 N/A INTRINSIC
Blast:FBOX 33 73 6e-8 BLAST
Pfam:Transglut_core2 215 390 3e-43 PFAM
low complexity region 482 491 N/A INTRINSIC
YccV-like 500 597 8.22e-39 SMART
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000202447
AA Change: A166S

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143873
Gene: ENSMUSG00000032898
AA Change: A166S

DomainStartEndE-ValueType
low complexity region 15 24 N/A INTRINSIC
Blast:FBOX 33 73 6e-8 BLAST
Pfam:Transglut_core2 215 390 3e-43 PFAM
low complexity region 482 491 N/A INTRINSIC
YccV-like 500 597 8.22e-39 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. Alternative splicing of this gene generates 2 transcript variants. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 A G 1: 89,630,485 Y165C probably damaging Het
Agbl3 A T 6: 34,839,365 T742S probably benign Het
Arhgef10l T C 4: 140,544,267 T651A probably benign Het
Arsb T A 13: 93,862,327 I381N probably damaging Het
Blzf1 A G 1: 164,295,909 V283A probably benign Het
C130060K24Rik T A 6: 65,441,217 V123D probably damaging Het
Cadps C T 14: 12,489,476 probably null Het
Casz1 A T 4: 148,938,249 T591S probably damaging Het
Ccne2 T C 4: 11,194,079 probably null Het
Chst9 T C 18: 15,452,277 T410A probably benign Het
Ciart G A 3: 95,881,344 P61L probably damaging Het
Fam234a T C 17: 26,218,198 D169G probably benign Het
Fat1 C T 8: 45,042,223 P4116L probably damaging Het
Gbf1 A G 19: 46,272,643 I1216V probably benign Het
Gper1 G A 5: 139,426,688 A263T probably benign Het
Hdlbp G T 1: 93,430,307 probably null Het
Ighg3 A T 12: 113,359,816 L280Q Het
Impa1 T C 3: 10,321,667 T171A probably benign Het
Ints7 T A 1: 191,615,747 Y744N possibly damaging Het
Irgc1 G T 7: 24,432,534 A286D probably damaging Het
Kif18a T C 2: 109,287,845 S2P probably damaging Het
Macf1 A T 4: 123,408,271 W813R probably damaging Het
Mapkbp1 T G 2: 120,012,073 H157Q probably damaging Het
Mfsd4b2 T A 10: 39,923,781 M42L probably benign Het
Mon2 A G 10: 123,059,186 probably null Het
Myrfl T A 10: 116,848,335 H161L probably benign Het
Olfr171 T C 16: 19,624,623 H159R probably damaging Het
Olfr832 A C 9: 18,945,259 S204R probably damaging Het
Phlpp2 T G 8: 109,925,842 V606G possibly damaging Het
Psmb5 T C 14: 54,616,755 T89A probably benign Het
Ptpn9 A G 9: 57,061,013 T546A probably benign Het
Rabep2 A G 7: 126,438,412 M146V possibly damaging Het
Rptn G A 3: 93,398,224 E955K possibly damaging Het
Samd3 G T 10: 26,263,872 V301F possibly damaging Het
Sh2b1 C A 7: 126,471,292 C380F probably benign Het
Shank1 A G 7: 44,351,598 M914V unknown Het
Sox2 G A 3: 34,650,642 R76H probably damaging Het
Stat5a T C 11: 100,880,317 F574S probably damaging Het
Tbx5 A G 5: 119,836,999 E29G probably benign Het
Trpm5 A C 7: 143,085,241 D264E probably damaging Het
Zfp442 T C 2: 150,409,719 S88G probably benign Het
Zfp62 T A 11: 49,217,328 F749I possibly damaging Het
Zfp677 T A 17: 21,398,015 S445T probably damaging Het
Zfp979 A C 4: 147,613,978 N91K probably damaging Het
Zfyve9 A G 4: 108,684,995 V209A possibly damaging Het
Zic4 G T 9: 91,384,244 A314S probably benign Het
Other mutations in Fbxo21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01721:Fbxo21 APN 5 117988790 missense probably benign 0.04
IGL02131:Fbxo21 APN 5 118002090 missense possibly damaging 0.76
IGL02156:Fbxo21 APN 5 117994668 splice site probably benign
IGL02195:Fbxo21 APN 5 118002154 missense probably damaging 1.00
IGL02702:Fbxo21 APN 5 118000510 missense probably damaging 1.00
PIT1430001:Fbxo21 UTSW 5 117977866 missense possibly damaging 0.68
R0008:Fbxo21 UTSW 5 118008013 missense possibly damaging 0.63
R0055:Fbxo21 UTSW 5 118000490 missense probably benign 0.12
R0055:Fbxo21 UTSW 5 118000490 missense probably benign 0.12
R0089:Fbxo21 UTSW 5 118008143 missense probably benign
R0101:Fbxo21 UTSW 5 117995456 missense probably damaging 1.00
R0815:Fbxo21 UTSW 5 117995508 splice site probably benign
R0866:Fbxo21 UTSW 5 117977033 missense probably benign 0.01
R1673:Fbxo21 UTSW 5 118008064 missense probably benign 0.27
R2048:Fbxo21 UTSW 5 118008104 missense probably damaging 1.00
R2063:Fbxo21 UTSW 5 117976966 missense probably benign 0.45
R2161:Fbxo21 UTSW 5 117995386 missense probably damaging 1.00
R2224:Fbxo21 UTSW 5 118008123 missense probably damaging 1.00
R3872:Fbxo21 UTSW 5 118000329 missense possibly damaging 0.70
R4750:Fbxo21 UTSW 5 118000468 missense probably benign 0.10
R5807:Fbxo21 UTSW 5 117976868 missense probably benign 0.01
R6075:Fbxo21 UTSW 5 117988883 missense probably damaging 0.97
R6528:Fbxo21 UTSW 5 118000356 missense probably benign 0.25
R7494:Fbxo21 UTSW 5 118000323 missense possibly damaging 0.86
R7498:Fbxo21 UTSW 5 118002174 critical splice donor site probably null
R7857:Fbxo21 UTSW 5 117988813 missense probably benign 0.21
R7944:Fbxo21 UTSW 5 118008147 missense possibly damaging 0.89
R7945:Fbxo21 UTSW 5 118008147 missense possibly damaging 0.89
R8116:Fbxo21 UTSW 5 117990854 missense possibly damaging 0.70
R8354:Fbxo21 UTSW 5 117995414 missense probably damaging 1.00
R8454:Fbxo21 UTSW 5 117995414 missense probably damaging 1.00
Z1177:Fbxo21 UTSW 5 117989171 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GTGTGCTCACTTCCCAGGATTC -3'
(R):5'- CTCTTCTGAAGCCCACTAGCAC -3'

Sequencing Primer
(F):5'- CAGGATTCCTTTCTCCAGAGATGTG -3'
(R):5'- CTTTTCCCGTCTGGAGGAACAG -3'
Posted On2019-11-26