Incidental Mutation 'R7801:Gper1'
ID600526
Institutional Source Beutler Lab
Gene Symbol Gper1
Ensembl Gene ENSMUSG00000053647
Gene NameG protein-coupled estrogen receptor 1
SynonymsFEG-1, Gpr30, Ceprl, 6330420K13Rik, Gper, GPCR-Br, CMKRL2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.256) question?
Stock #R7801 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location139423151-139427800 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 139426688 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 263 (A263T)
Ref Sequence ENSEMBL: ENSMUSP00000080370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066052] [ENSMUST00000066211] [ENSMUST00000198474]
Predicted Effect probably benign
Transcript: ENSMUST00000066052
SMART Domains Protein: ENSMUSP00000069230
Gene: ENSMUSG00000053553

DomainStartEndE-ValueType
low complexity region 54 77 N/A INTRINSIC
Pfam:DUF2373 103 165 3e-26 PFAM
low complexity region 184 194 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000066211
AA Change: A263T

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000080370
Gene: ENSMUSG00000053647
AA Change: A263T

DomainStartEndE-ValueType
Pfam:7tm_1 76 324 2e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198474
SMART Domains Protein: ENSMUSP00000142949
Gene: ENSMUSG00000053553

DomainStartEndE-ValueType
low complexity region 54 77 N/A INTRINSIC
Pfam:DUF2373 102 141 9e-12 PFAM
Meta Mutation Damage Score 0.4684 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the G-protein coupled receptor 1 family and encodes a multi-pass membrane protein that localizes to the endoplasmic reticulum. The protein binds estrogen, resulting in intracellular calcium mobilization and synthesis of phosphatidylinositol 3,4,5-trisphosphate in the nucleus. This protein therefore plays a role in the rapid nongenomic signaling events widely observed following stimulation of cells and tissues with estrogen. Alternate transcriptional splice variants which encode the same protein have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knockout allele exhibit decreased thymic atrophy, insulin, and glucagon responses following treatment with PGE2. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 A G 1: 89,630,485 Y165C probably damaging Het
Agbl3 A T 6: 34,839,365 T742S probably benign Het
Arhgef10l T C 4: 140,544,267 T651A probably benign Het
Arsb T A 13: 93,862,327 I381N probably damaging Het
Blzf1 A G 1: 164,295,909 V283A probably benign Het
C130060K24Rik T A 6: 65,441,217 V123D probably damaging Het
Cadps C T 14: 12,489,476 probably null Het
Casz1 A T 4: 148,938,249 T591S probably damaging Het
Ccne2 T C 4: 11,194,079 probably null Het
Chst9 T C 18: 15,452,277 T410A probably benign Het
Ciart G A 3: 95,881,344 P61L probably damaging Het
Fam234a T C 17: 26,218,198 D169G probably benign Het
Fat1 C T 8: 45,042,223 P4116L probably damaging Het
Fbxo21 G T 5: 117,986,124 A166S probably damaging Het
Gbf1 A G 19: 46,272,643 I1216V probably benign Het
Hdlbp G T 1: 93,430,307 probably null Het
Ighg3 A T 12: 113,359,816 L280Q Het
Impa1 T C 3: 10,321,667 T171A probably benign Het
Ints7 T A 1: 191,615,747 Y744N possibly damaging Het
Irgc1 G T 7: 24,432,534 A286D probably damaging Het
Kif18a T C 2: 109,287,845 S2P probably damaging Het
Macf1 A T 4: 123,408,271 W813R probably damaging Het
Mapkbp1 T G 2: 120,012,073 H157Q probably damaging Het
Mfsd4b2 T A 10: 39,923,781 M42L probably benign Het
Mon2 A G 10: 123,059,186 probably null Het
Myrfl T A 10: 116,848,335 H161L probably benign Het
Olfr171 T C 16: 19,624,623 H159R probably damaging Het
Olfr832 A C 9: 18,945,259 S204R probably damaging Het
Phlpp2 T G 8: 109,925,842 V606G possibly damaging Het
Psmb5 T C 14: 54,616,755 T89A probably benign Het
Ptpn9 A G 9: 57,061,013 T546A probably benign Het
Rabep2 A G 7: 126,438,412 M146V possibly damaging Het
Rptn G A 3: 93,398,224 E955K possibly damaging Het
Samd3 G T 10: 26,263,872 V301F possibly damaging Het
Sh2b1 C A 7: 126,471,292 C380F probably benign Het
Shank1 A G 7: 44,351,598 M914V unknown Het
Sox2 G A 3: 34,650,642 R76H probably damaging Het
Stat5a T C 11: 100,880,317 F574S probably damaging Het
Tbx5 A G 5: 119,836,999 E29G probably benign Het
Trpm5 A C 7: 143,085,241 D264E probably damaging Het
Zfp442 T C 2: 150,409,719 S88G probably benign Het
Zfp62 T A 11: 49,217,328 F749I possibly damaging Het
Zfp677 T A 17: 21,398,015 S445T probably damaging Het
Zfp979 A C 4: 147,613,978 N91K probably damaging Het
Zfyve9 A G 4: 108,684,995 V209A possibly damaging Het
Zic4 G T 9: 91,384,244 A314S probably benign Het
Other mutations in Gper1
AlleleSourceChrCoordTypePredicted EffectPPH Score
P0040:Gper1 UTSW 5 139426488 missense probably benign 0.00
R1233:Gper1 UTSW 5 139426602 missense probably damaging 1.00
R1785:Gper1 UTSW 5 139426722 missense probably damaging 1.00
R1786:Gper1 UTSW 5 139426722 missense probably damaging 1.00
R2078:Gper1 UTSW 5 139426133 missense probably benign 0.30
R3827:Gper1 UTSW 5 139427000 missense probably benign 0.10
R4604:Gper1 UTSW 5 139426725 missense probably damaging 0.98
R4914:Gper1 UTSW 5 139426868 missense probably benign 0.35
R5171:Gper1 UTSW 5 139426658 missense probably damaging 1.00
R6836:Gper1 UTSW 5 139426680 missense probably damaging 0.98
R8302:Gper1 UTSW 5 139426275 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- TCATCTGGATGGCCTCAGTGTC -3'
(R):5'- TTCAGGCAGCTGTTGGAGAAG -3'

Sequencing Primer
(F):5'- TTCACAGCGGTGCACCTG -3'
(R):5'- AGGCTGCAAGGTTGACTATG -3'
Posted On2019-11-26