Mutagenetix > Incidental Mutation

Incidental Mutation 'R7801:Agbl3'

600527

Institutional Source

Beutler Lab

Gene Symbol

Agbl3

Ensembl Gene

ENSMUSG00000038836

Gene Name

ATP/GTP binding protein-like 3

Synonyms

4930431N21Rik, 2900053G10Rik, 6530406M24Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7801 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

34780432-34859459 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 34839365 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 742 (T742S)

Ref Sequence

ENSEMBL: ENSMUSP00000110668 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115016] [ENSMUST00000115017] [ENSMUST00000148834]

AlphaFold

Q8CDP0

Predicted Effect

probably benign
Transcript: ENSMUST00000115016
AA Change: T742S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000110668
Gene: ENSMUSG00000038836
AA Change: T742S

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:Peptidase_M14	314	563	2.7e-19	PFAM
low complexity region	614	629	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000115017
AA Change: T737S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000110669
Gene: ENSMUSG00000038836
AA Change: T737S

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:Peptidase_M14	309	560	1e-33	PFAM
low complexity region	609	624	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000148834

SMART Domains

Protein: ENSMUSP00000116066
Gene: ENSMUSG00000038836

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (47/47)

MGI Phenotype

PHENOTYPE: Homozygous mice for a targeted allele are viable and fertile. Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agap1	A	G	1: 89,630,485	Y165C	probably damaging	Het
Arhgef10l	T	C	4: 140,544,267	T651A	probably benign	Het
Arsb	T	A	13: 93,862,327	I381N	probably damaging	Het
Blzf1	A	G	1: 164,295,909	V283A	probably benign	Het
C130060K24Rik	T	A	6: 65,441,217	V123D	probably damaging	Het
Cadps	C	T	14: 12,489,476		probably null	Het
Casz1	A	T	4: 148,938,249	T591S	probably damaging	Het
Ccne2	T	C	4: 11,194,079		probably null	Het
Chst9	T	C	18: 15,452,277	T410A	probably benign	Het
Ciart	G	A	3: 95,881,344	P61L	probably damaging	Het
Fam234a	T	C	17: 26,218,198	D169G	probably benign	Het
Fat1	C	T	8: 45,042,223	P4116L	probably damaging	Het
Fbxo21	G	T	5: 117,986,124	A166S	probably damaging	Het
Gbf1	A	G	19: 46,272,643	I1216V	probably benign	Het
Gper1	G	A	5: 139,426,688	A263T	probably benign	Het
Hdlbp	G	T	1: 93,430,307		probably null	Het
Ighg3	A	T	12: 113,359,816	L280Q		Het
Impa1	T	C	3: 10,321,667	T171A	probably benign	Het
Ints7	T	A	1: 191,615,747	Y744N	possibly damaging	Het
Irgc1	G	T	7: 24,432,534	A286D	probably damaging	Het
Kif18a	T	C	2: 109,287,845	S2P	probably damaging	Het
Macf1	A	T	4: 123,408,271	W813R	probably damaging	Het
Mapkbp1	T	G	2: 120,012,073	H157Q	probably damaging	Het
Mfsd4b2	T	A	10: 39,923,781	M42L	probably benign	Het
Mon2	A	G	10: 123,059,186		probably null	Het
Myrfl	T	A	10: 116,848,335	H161L	probably benign	Het
Olfr171	T	C	16: 19,624,623	H159R	probably damaging	Het
Olfr832	A	C	9: 18,945,259	S204R	probably damaging	Het
Phlpp2	T	G	8: 109,925,842	V606G	possibly damaging	Het
Psmb5	T	C	14: 54,616,755	T89A	probably benign	Het
Ptpn9	A	G	9: 57,061,013	T546A	probably benign	Het
Rabep2	A	G	7: 126,438,412	M146V	possibly damaging	Het
Rptn	G	A	3: 93,398,224	E955K	possibly damaging	Het
Samd3	G	T	10: 26,263,872	V301F	possibly damaging	Het
Sh2b1	C	A	7: 126,471,292	C380F	probably benign	Het
Shank1	A	G	7: 44,351,598	M914V	unknown	Het
Sox2	G	A	3: 34,650,642	R76H	probably damaging	Het
Stat5a	T	C	11: 100,880,317	F574S	probably damaging	Het
Tbx5	A	G	5: 119,836,999	E29G	probably benign	Het
Trpm5	A	C	7: 143,085,241	D264E	probably damaging	Het
Zfp442	T	C	2: 150,409,719	S88G	probably benign	Het
Zfp62	T	A	11: 49,217,328	F749I	possibly damaging	Het
Zfp677	T	A	17: 21,398,015	S445T	probably damaging	Het
Zfp979	A	C	4: 147,613,978	N91K	probably damaging	Het
Zfyve9	A	G	4: 108,684,995	V209A	possibly damaging	Het
Zic4	G	T	9: 91,384,244	A314S	probably benign	Het

Other mutations in Agbl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Agbl3	APN	6	34846836	missense	probably damaging	1.00
IGL00835:Agbl3	APN	6	34799732	missense	probably damaging	1.00
IGL00840:Agbl3	APN	6	34799159	missense	possibly damaging	0.95
IGL01090:Agbl3	APN	6	34799887	missense	probably benign	0.40
IGL01123:Agbl3	APN	6	34846976	nonsense	probably null
IGL01707:Agbl3	APN	6	34839454	missense	possibly damaging	0.78
IGL01728:Agbl3	APN	6	34782157	start codon destroyed	probably null
IGL02335:Agbl3	APN	6	34799750	missense	probably damaging	1.00
IGL02420:Agbl3	APN	6	34785307	missense	possibly damaging	0.47
IGL02551:Agbl3	APN	6	34823071	missense	possibly damaging	0.88
IGL02974:Agbl3	APN	6	34799822	missense	probably damaging	1.00
IGL03167:Agbl3	APN	6	34857659	missense	possibly damaging	0.92
IGL03182:Agbl3	APN	6	34803500	missense	probably damaging	1.00
R0044:Agbl3	UTSW	6	34799899	missense	probably damaging	1.00
R0499:Agbl3	UTSW	6	34839335	missense	probably benign
R0639:Agbl3	UTSW	6	34799705	missense	probably damaging	1.00
R0850:Agbl3	UTSW	6	34799204	missense	probably damaging	1.00
R1004:Agbl3	UTSW	6	34803451	missense	probably damaging	0.99
R1080:Agbl3	UTSW	6	34828235	missense	probably benign	0.14
R1589:Agbl3	UTSW	6	34857517	missense	possibly damaging	0.77
R2361:Agbl3	UTSW	6	34832505	missense	possibly damaging	0.87
R2495:Agbl3	UTSW	6	34846764	missense	probably damaging	1.00
R3236:Agbl3	UTSW	6	34823087	splice site	probably null
R3237:Agbl3	UTSW	6	34823087	splice site	probably null
R3420:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3421:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3422:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3810:Agbl3	UTSW	6	34799729	missense	probably damaging	1.00
R3811:Agbl3	UTSW	6	34799729	missense	probably damaging	1.00
R4059:Agbl3	UTSW	6	34846899	missense	probably damaging	1.00
R4499:Agbl3	UTSW	6	34857598	missense	probably benign	0.00
R4687:Agbl3	UTSW	6	34798326	missense	probably damaging	1.00
R4854:Agbl3	UTSW	6	34785284	missense	probably damaging	0.97
R5354:Agbl3	UTSW	6	34814752	missense	probably benign	0.03
R5386:Agbl3	UTSW	6	34799196	missense	probably damaging	1.00
R5897:Agbl3	UTSW	6	34803573	missense	probably benign	0.21
R6018:Agbl3	UTSW	6	34799255	missense	probably damaging	1.00
R6148:Agbl3	UTSW	6	34857753	missense	possibly damaging	0.87
R6305:Agbl3	UTSW	6	34782210	missense	unknown
R6525:Agbl3	UTSW	6	34803594	nonsense	probably null
R6546:Agbl3	UTSW	6	34799299	missense	probably damaging	1.00
R6743:Agbl3	UTSW	6	34846953	missense	probably benign	0.03
R6986:Agbl3	UTSW	6	34839452	missense	probably benign	0.42
R7023:Agbl3	UTSW	6	34814769	missense	probably benign	0.02
R7411:Agbl3	UTSW	6	34814819	missense	probably damaging	0.99
R7469:Agbl3	UTSW	6	34814414	missense	probably damaging	1.00
R7631:Agbl3	UTSW	6	34857671	missense	possibly damaging	0.95
R7658:Agbl3	UTSW	6	34832508	missense	probably benign	0.11
R7743:Agbl3	UTSW	6	34846830	missense	probably damaging	1.00
R8033:Agbl3	UTSW	6	34839494	missense	possibly damaging	0.95
R8203:Agbl3	UTSW	6	34799479	missense	probably damaging	1.00
R8769:Agbl3	UTSW	6	34857614	missense	probably damaging	0.96
R9072:Agbl3	UTSW	6	34799452	missense	probably damaging	1.00
R9073:Agbl3	UTSW	6	34799452	missense	probably damaging	1.00
R9210:Agbl3	UTSW	6	34798242	missense	probably damaging	0.98
R9255:Agbl3	UTSW	6	34812905	missense	probably damaging	1.00
R9536:Agbl3	UTSW	6	34846926	missense	probably benign
R9560:Agbl3	UTSW	6	34846908	missense	possibly damaging	0.94
R9662:Agbl3	UTSW	6	34832533	nonsense	probably null
RF014:Agbl3	UTSW	6	34799358	missense	possibly damaging	0.53
Z1177:Agbl3	UTSW	6	34799408	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCATGCAGGCACAAGTACATAC -3'
(R):5'- TAGTTCCCATAACTCAGATTGGATG -3'

Sequencing Primer
(F):5'- GGACTAGTCCTAGCTATTCTGAC -3'
(R):5'- GTTCATAGGACATTTCGCCA -3'

Posted On

2019-11-26