Incidental Mutation 'R7801:Rabep2'
List |< first << previous [record 33 of 47] next >> last >|
ID600531
Institutional Source Beutler Lab
Gene Symbol Rabep2
Ensembl Gene ENSMUSG00000030727
Gene Namerabaptin, RAB GTPase binding effector protein 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.846) question?
Stock #R7801 (G1)
Quality Score200.009
Status Validated
Chromosome7
Chromosomal Location126428759-126449245 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 126438412 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 146 (M146V)
Ref Sequence ENSEMBL: ENSMUSP00000102015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106405] [ENSMUST00000106407] [ENSMUST00000150530] [ENSMUST00000150933]
Predicted Effect possibly damaging
Transcript: ENSMUST00000106405
AA Change: M103V

PolyPhen 2 Score 0.657 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000102013
Gene: ENSMUSG00000030727
AA Change: M103V

DomainStartEndE-ValueType
Pfam:Rabaptin 2 107 1.4e-41 PFAM
low complexity region 139 158 N/A INTRINSIC
low complexity region 175 194 N/A INTRINSIC
Pfam:Rabaptin 196 311 5.9e-10 PFAM
Pfam:Rab5-bind 289 456 4.6e-36 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106407
AA Change: M146V

PolyPhen 2 Score 0.657 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000102015
Gene: ENSMUSG00000030727
AA Change: M146V

DomainStartEndE-ValueType
Pfam:Rabaptin 13 171 1.4e-39 PFAM
low complexity region 182 201 N/A INTRINSIC
low complexity region 218 237 N/A INTRINSIC
Pfam:Rab5-bind 274 487 4.1e-21 PFAM
Pfam:Rab5-bind 469 531 1.6e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150530
SMART Domains Protein: ENSMUSP00000122141
Gene: ENSMUSG00000030727

DomainStartEndE-ValueType
Pfam:Rabaptin 5 54 1.6e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150933
SMART Domains Protein: ENSMUSP00000123559
Gene: ENSMUSG00000030727

DomainStartEndE-ValueType
Pfam:Rabaptin 2 91 2e-37 PFAM
Meta Mutation Damage Score 0.1506 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 A G 1: 89,630,485 Y165C probably damaging Het
Agbl3 A T 6: 34,839,365 T742S probably benign Het
Arhgef10l T C 4: 140,544,267 T651A probably benign Het
Arsb T A 13: 93,862,327 I381N probably damaging Het
Blzf1 A G 1: 164,295,909 V283A probably benign Het
C130060K24Rik T A 6: 65,441,217 V123D probably damaging Het
Cadps C T 14: 12,489,476 probably null Het
Casz1 A T 4: 148,938,249 T591S probably damaging Het
Ccne2 T C 4: 11,194,079 probably null Het
Chst9 T C 18: 15,452,277 T410A probably benign Het
Ciart G A 3: 95,881,344 P61L probably damaging Het
Fam234a T C 17: 26,218,198 D169G probably benign Het
Fat1 C T 8: 45,042,223 P4116L probably damaging Het
Fbxo21 G T 5: 117,986,124 A166S probably damaging Het
Gbf1 A G 19: 46,272,643 I1216V probably benign Het
Gper1 G A 5: 139,426,688 A263T probably benign Het
Hdlbp G T 1: 93,430,307 probably null Het
Ighg3 A T 12: 113,359,816 L280Q Het
Impa1 T C 3: 10,321,667 T171A probably benign Het
Ints7 T A 1: 191,615,747 Y744N possibly damaging Het
Irgc1 G T 7: 24,432,534 A286D probably damaging Het
Kif18a T C 2: 109,287,845 S2P probably damaging Het
Macf1 A T 4: 123,408,271 W813R probably damaging Het
Mapkbp1 T G 2: 120,012,073 H157Q probably damaging Het
Mfsd4b2 T A 10: 39,923,781 M42L probably benign Het
Mon2 A G 10: 123,059,186 probably null Het
Myrfl T A 10: 116,848,335 H161L probably benign Het
Olfr171 T C 16: 19,624,623 H159R probably damaging Het
Olfr832 A C 9: 18,945,259 S204R probably damaging Het
Phlpp2 T G 8: 109,925,842 V606G possibly damaging Het
Psmb5 T C 14: 54,616,755 T89A probably benign Het
Ptpn9 A G 9: 57,061,013 T546A probably benign Het
Rptn G A 3: 93,398,224 E955K possibly damaging Het
Samd3 G T 10: 26,263,872 V301F possibly damaging Het
Sh2b1 C A 7: 126,471,292 C380F probably benign Het
Shank1 A G 7: 44,351,598 M914V unknown Het
Sox2 G A 3: 34,650,642 R76H probably damaging Het
Stat5a T C 11: 100,880,317 F574S probably damaging Het
Tbx5 A G 5: 119,836,999 E29G probably benign Het
Trpm5 A C 7: 143,085,241 D264E probably damaging Het
Zfp442 T C 2: 150,409,719 S88G probably benign Het
Zfp62 T A 11: 49,217,328 F749I possibly damaging Het
Zfp677 T A 17: 21,398,015 S445T probably damaging Het
Zfp979 A C 4: 147,613,978 N91K probably damaging Het
Zfyve9 A G 4: 108,684,995 V209A possibly damaging Het
Zic4 G T 9: 91,384,244 A314S probably benign Het
Other mutations in Rabep2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02203:Rabep2 APN 7 126440394 missense possibly damaging 0.56
R0799:Rabep2 UTSW 7 126438724 missense probably damaging 1.00
R1219:Rabep2 UTSW 7 126429627 missense probably damaging 1.00
R1731:Rabep2 UTSW 7 126444272 missense probably damaging 1.00
R1735:Rabep2 UTSW 7 126444540 missense probably damaging 1.00
R1789:Rabep2 UTSW 7 126438799 missense possibly damaging 0.76
R1951:Rabep2 UTSW 7 126438564 missense possibly damaging 0.67
R2113:Rabep2 UTSW 7 126445288 splice site probably null
R4008:Rabep2 UTSW 7 126445374 missense probably damaging 1.00
R4357:Rabep2 UTSW 7 126448225 missense probably damaging 1.00
R4915:Rabep2 UTSW 7 126444922 missense probably damaging 1.00
R5176:Rabep2 UTSW 7 126434293 intron probably benign
R5512:Rabep2 UTSW 7 126438799 missense possibly damaging 0.76
R6729:Rabep2 UTSW 7 126440197 missense probably benign 0.00
R7055:Rabep2 UTSW 7 126445313 missense possibly damaging 0.94
R7288:Rabep2 UTSW 7 126444205 missense probably damaging 1.00
R7419:Rabep2 UTSW 7 126444170 missense probably benign 0.07
R7426:Rabep2 UTSW 7 126438719 missense probably damaging 1.00
R7477:Rabep2 UTSW 7 126444818 critical splice acceptor site probably null
R7823:Rabep2 UTSW 7 126438721 missense probably damaging 1.00
R8245:Rabep2 UTSW 7 126440408 missense possibly damaging 0.93
R8265:Rabep2 UTSW 7 126444251 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACGGTTTTAAACGATGGATGTTGC -3'
(R):5'- AGCAACTCTGTGGAGCCATG -3'

Sequencing Primer
(F):5'- CCTTTCCCTGGAAGCACTTAGAG -3'
(R):5'- TCTGTGGAGCCATGCAGGG -3'
Posted On2019-11-26