Incidental Mutation 'R7801:Sh2b1'
ID600532
Institutional Source Beutler Lab
Gene Symbol Sh2b1
Ensembl Gene ENSMUSG00000030733
Gene NameSH2B adaptor protein 1
SynonymsIrip, SH2-Bb, SH2-B, Sh2bpsm1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.370) question?
Stock #R7801 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location126466994-126475424 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 126471292 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 380 (C380F)
Ref Sequence ENSEMBL: ENSMUSP00000145754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032978] [ENSMUST00000205340] [ENSMUST00000205440] [ENSMUST00000205497] [ENSMUST00000205733] [ENSMUST00000205889] [ENSMUST00000206643] [ENSMUST00000206664]
Predicted Effect probably benign
Transcript: ENSMUST00000032978
AA Change: C380F

PolyPhen 2 Score 0.156 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000032978
Gene: ENSMUSG00000030733
AA Change: C380F

DomainStartEndE-ValueType
Pfam:Phe_ZIP 25 81 4.6e-25 PFAM
low complexity region 83 99 N/A INTRINSIC
low complexity region 133 151 N/A INTRINSIC
low complexity region 156 168 N/A INTRINSIC
low complexity region 195 205 N/A INTRINSIC
PH 247 378 4.82e-7 SMART
low complexity region 447 460 N/A INTRINSIC
low complexity region 466 483 N/A INTRINSIC
SH2 525 610 2.84e-23 SMART
low complexity region 668 677 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205340
AA Change: C380F

PolyPhen 2 Score 0.310 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000205440
AA Change: C380F

PolyPhen 2 Score 0.310 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000205497
AA Change: C380F

PolyPhen 2 Score 0.445 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000205733
AA Change: C380F

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000205889
AA Change: C380F

PolyPhen 2 Score 0.445 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000206643
Predicted Effect probably benign
Transcript: ENSMUST00000206664
AA Change: C380F

PolyPhen 2 Score 0.284 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.0967 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SH2-domain containing mediators family. The encoded protein mediates activation of various kinases and may function in cytokine and growth factor receptor signaling and cellular transformation. Alternatively spliced transcript variants have been described. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous null mice are infertile. Female mice have small, anovulatory ovaries with reduced numbers of follicles and male mice exhibit small testes and sperm deficits. Mice homozygous for a floxed allele activated in the pancreas exhibit impaired glucose homeostasis when fed a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 A G 1: 89,630,485 Y165C probably damaging Het
Agbl3 A T 6: 34,839,365 T742S probably benign Het
Arhgef10l T C 4: 140,544,267 T651A probably benign Het
Arsb T A 13: 93,862,327 I381N probably damaging Het
Blzf1 A G 1: 164,295,909 V283A probably benign Het
C130060K24Rik T A 6: 65,441,217 V123D probably damaging Het
Cadps C T 14: 12,489,476 probably null Het
Casz1 A T 4: 148,938,249 T591S probably damaging Het
Ccne2 T C 4: 11,194,079 probably null Het
Chst9 T C 18: 15,452,277 T410A probably benign Het
Ciart G A 3: 95,881,344 P61L probably damaging Het
Fam234a T C 17: 26,218,198 D169G probably benign Het
Fat1 C T 8: 45,042,223 P4116L probably damaging Het
Fbxo21 G T 5: 117,986,124 A166S probably damaging Het
Gbf1 A G 19: 46,272,643 I1216V probably benign Het
Gper1 G A 5: 139,426,688 A263T probably benign Het
Hdlbp G T 1: 93,430,307 probably null Het
Ighg3 A T 12: 113,359,816 L280Q Het
Impa1 T C 3: 10,321,667 T171A probably benign Het
Ints7 T A 1: 191,615,747 Y744N possibly damaging Het
Irgc1 G T 7: 24,432,534 A286D probably damaging Het
Kif18a T C 2: 109,287,845 S2P probably damaging Het
Macf1 A T 4: 123,408,271 W813R probably damaging Het
Mapkbp1 T G 2: 120,012,073 H157Q probably damaging Het
Mfsd4b2 T A 10: 39,923,781 M42L probably benign Het
Mon2 A G 10: 123,059,186 probably null Het
Myrfl T A 10: 116,848,335 H161L probably benign Het
Olfr171 T C 16: 19,624,623 H159R probably damaging Het
Olfr832 A C 9: 18,945,259 S204R probably damaging Het
Phlpp2 T G 8: 109,925,842 V606G possibly damaging Het
Psmb5 T C 14: 54,616,755 T89A probably benign Het
Ptpn9 A G 9: 57,061,013 T546A probably benign Het
Rabep2 A G 7: 126,438,412 M146V possibly damaging Het
Rptn G A 3: 93,398,224 E955K possibly damaging Het
Samd3 G T 10: 26,263,872 V301F possibly damaging Het
Shank1 A G 7: 44,351,598 M914V unknown Het
Sox2 G A 3: 34,650,642 R76H probably damaging Het
Stat5a T C 11: 100,880,317 F574S probably damaging Het
Tbx5 A G 5: 119,836,999 E29G probably benign Het
Trpm5 A C 7: 143,085,241 D264E probably damaging Het
Zfp442 T C 2: 150,409,719 S88G probably benign Het
Zfp62 T A 11: 49,217,328 F749I possibly damaging Het
Zfp677 T A 17: 21,398,015 S445T probably damaging Het
Zfp979 A C 4: 147,613,978 N91K probably damaging Het
Zfyve9 A G 4: 108,684,995 V209A possibly damaging Het
Zic4 G T 9: 91,384,244 A314S probably benign Het
Other mutations in Sh2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02096:Sh2b1 APN 7 126469293 missense probably damaging 0.99
IGL02320:Sh2b1 APN 7 126469169 missense probably benign 0.02
IGL02589:Sh2b1 APN 7 126469268 missense probably benign 0.19
IGL02668:Sh2b1 APN 7 126472474 missense possibly damaging 0.62
IGL03189:Sh2b1 APN 7 126468530 missense possibly damaging 0.61
R0130:Sh2b1 UTSW 7 126471448 missense possibly damaging 0.95
R0532:Sh2b1 UTSW 7 126472272 missense probably benign 0.00
R2081:Sh2b1 UTSW 7 126472690 missense possibly damaging 0.62
R2109:Sh2b1 UTSW 7 126472364 missense possibly damaging 0.74
R2409:Sh2b1 UTSW 7 126471479 missense probably damaging 1.00
R2566:Sh2b1 UTSW 7 126468926 missense probably damaging 0.99
R3752:Sh2b1 UTSW 7 126468787 missense probably damaging 1.00
R4675:Sh2b1 UTSW 7 126471446 missense possibly damaging 0.79
R4970:Sh2b1 UTSW 7 126468803 missense probably damaging 1.00
R5102:Sh2b1 UTSW 7 126471236 missense probably benign
R5912:Sh2b1 UTSW 7 126471470 missense probably damaging 1.00
R7368:Sh2b1 UTSW 7 126468513 missense possibly damaging 0.59
R7694:Sh2b1 UTSW 7 126467757 missense probably benign 0.03
R8005:Sh2b1 UTSW 7 126469307 missense possibly damaging 0.82
R8353:Sh2b1 UTSW 7 126467570 utr 3 prime probably benign
R8356:Sh2b1 UTSW 7 126467570 utr 3 prime probably benign
R8453:Sh2b1 UTSW 7 126467570 utr 3 prime probably benign
R8456:Sh2b1 UTSW 7 126467570 utr 3 prime probably benign
R8456:Sh2b1 UTSW 7 126467600 nonsense probably null
Z1176:Sh2b1 UTSW 7 126467731 missense probably benign 0.23
Z1177:Sh2b1 UTSW 7 126471123 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGTAGGTCATAGGTAGAGCAGC -3'
(R):5'- TCCTGGAGACAAGTGATGCG -3'

Sequencing Primer
(F):5'- TCACACGGGCTCGACCTTAC -3'
(R):5'- GACAAGTGATGCGCTTCATG -3'
Posted On2019-11-26