Incidental Mutation 'R7801:Olfr832'
ID600536
Institutional Source Beutler Lab
Gene Symbol Olfr832
Ensembl Gene ENSMUSG00000095957
Gene Nameolfactory receptor 832
SynonymsMOR153-1, GA_x6K02T2PVTD-12687800-12688738
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.239) question?
Stock #R7801 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location18937122-18948940 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 18945259 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 204 (S204R)
Ref Sequence ENSEMBL: ENSMUSP00000151834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060601] [ENSMUST00000218385]
Predicted Effect probably damaging
Transcript: ENSMUST00000060601
AA Change: S204R

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000056724
Gene: ENSMUSG00000095957
AA Change: S204R

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.1e-51 PFAM
Pfam:7TM_GPCR_Srsx 35 305 3.1e-6 PFAM
Pfam:7tm_1 41 290 1.4e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000218385
AA Change: S204R

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 A G 1: 89,630,485 Y165C probably damaging Het
Agbl3 A T 6: 34,839,365 T742S probably benign Het
Arhgef10l T C 4: 140,544,267 T651A probably benign Het
Arsb T A 13: 93,862,327 I381N probably damaging Het
Blzf1 A G 1: 164,295,909 V283A probably benign Het
C130060K24Rik T A 6: 65,441,217 V123D probably damaging Het
Cadps C T 14: 12,489,476 probably null Het
Casz1 A T 4: 148,938,249 T591S probably damaging Het
Ccne2 T C 4: 11,194,079 probably null Het
Chst9 T C 18: 15,452,277 T410A probably benign Het
Ciart G A 3: 95,881,344 P61L probably damaging Het
Fam234a T C 17: 26,218,198 D169G probably benign Het
Fat1 C T 8: 45,042,223 P4116L probably damaging Het
Fbxo21 G T 5: 117,986,124 A166S probably damaging Het
Gbf1 A G 19: 46,272,643 I1216V probably benign Het
Gper1 G A 5: 139,426,688 A263T probably benign Het
Hdlbp G T 1: 93,430,307 probably null Het
Ighg3 A T 12: 113,359,816 L280Q Het
Impa1 T C 3: 10,321,667 T171A probably benign Het
Ints7 T A 1: 191,615,747 Y744N possibly damaging Het
Irgc1 G T 7: 24,432,534 A286D probably damaging Het
Kif18a T C 2: 109,287,845 S2P probably damaging Het
Macf1 A T 4: 123,408,271 W813R probably damaging Het
Mapkbp1 T G 2: 120,012,073 H157Q probably damaging Het
Mfsd4b2 T A 10: 39,923,781 M42L probably benign Het
Mon2 A G 10: 123,059,186 probably null Het
Myrfl T A 10: 116,848,335 H161L probably benign Het
Olfr171 T C 16: 19,624,623 H159R probably damaging Het
Phlpp2 T G 8: 109,925,842 V606G possibly damaging Het
Psmb5 T C 14: 54,616,755 T89A probably benign Het
Ptpn9 A G 9: 57,061,013 T546A probably benign Het
Rabep2 A G 7: 126,438,412 M146V possibly damaging Het
Rptn G A 3: 93,398,224 E955K possibly damaging Het
Samd3 G T 10: 26,263,872 V301F possibly damaging Het
Sh2b1 C A 7: 126,471,292 C380F probably benign Het
Shank1 A G 7: 44,351,598 M914V unknown Het
Sox2 G A 3: 34,650,642 R76H probably damaging Het
Stat5a T C 11: 100,880,317 F574S probably damaging Het
Tbx5 A G 5: 119,836,999 E29G probably benign Het
Trpm5 A C 7: 143,085,241 D264E probably damaging Het
Zfp442 T C 2: 150,409,719 S88G probably benign Het
Zfp62 T A 11: 49,217,328 F749I possibly damaging Het
Zfp677 T A 17: 21,398,015 S445T probably damaging Het
Zfp979 A C 4: 147,613,978 N91K probably damaging Het
Zfyve9 A G 4: 108,684,995 V209A possibly damaging Het
Zic4 G T 9: 91,384,244 A314S probably benign Het
Other mutations in Olfr832
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03018:Olfr832 APN 9 18944881 missense probably damaging 0.98
IGL03172:Olfr832 APN 9 18945461 missense probably benign 0.01
R0537:Olfr832 UTSW 9 18945148 missense probably damaging 1.00
R1923:Olfr832 UTSW 9 18945485 missense probably benign 0.21
R2226:Olfr832 UTSW 9 18944881 missense probably damaging 0.98
R2234:Olfr832 UTSW 9 18944816 missense probably damaging 1.00
R2402:Olfr832 UTSW 9 18945200 missense probably damaging 0.98
R4060:Olfr832 UTSW 9 18945050 missense probably benign 0.09
R4537:Olfr832 UTSW 9 18945230 missense possibly damaging 0.85
R4715:Olfr832 UTSW 9 18945446 missense probably benign 0.01
R5557:Olfr832 UTSW 9 18945170 missense possibly damaging 0.94
R6001:Olfr832 UTSW 9 18945044 missense probably damaging 1.00
R6172:Olfr832 UTSW 9 18944746 missense probably benign 0.00
R6415:Olfr832 UTSW 9 18945119 missense probably damaging 1.00
R6594:Olfr832 UTSW 9 18944831 missense probably damaging 0.98
R6874:Olfr832 UTSW 9 18945481 missense possibly damaging 0.95
R7818:Olfr832 UTSW 9 18945009 nonsense probably null
R7880:Olfr832 UTSW 9 18944728 missense probably benign 0.06
R7890:Olfr832 UTSW 9 18945503 missense probably benign 0.10
R8352:Olfr832 UTSW 9 18945163 missense possibly damaging 0.51
R8452:Olfr832 UTSW 9 18945163 missense possibly damaging 0.51
Z1088:Olfr832 UTSW 9 18945421 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- AATCCCAAACTCTGTGGGGTG -3'
(R):5'- TTCTGGAGCTATGAGTGCCAG -3'

Sequencing Primer
(F):5'- CAAACTCTGTGGGGTGATGGTTTTG -3'
(R):5'- GCTATGAGTGCCAGCAGAAC -3'
Posted On2019-11-26